Skip to main content

Table 2 Primers used in this work

From: Identification of new IS711 insertion sites in Brucella abortus field isolates

Name Sequence (5'-3') Reference
711d CATATGATGGGACCAAACACCTAGGG [19]
711u CACAAGACTGCGTTGCCGACAGA [19]
RB51 CCCCGGAAGATATGCTTCGATCC [12]
IS711out CAAGTTGAAACGCTATCGTCGC This work
P5 CGGCCCCGGT [20]
BruAb1_0736F TTGGTTTCCTTGCGACAGAT This work
BruAb1_0737R AACCTTGCCTTTAGTTGCTCA This work
BruAb2_0461F ATCAGGCTTTGCTGGCAATC This work
BruAb2_0461R TCGTTTGCCATCTTGTTCAG This work
marR-F1 GACGTGGTGGAGGAAACCTA This work
marR-R2 ACTCGGCCAAACCTGATAA This work
marR-F3 TTATCAGGTTTTGGCCGAGTCACATTGGAGTTGACCATCG This work
marR-R4 CGCTTCGTGGTACGCTATTT This work