Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

Amplified gene/region Primer Name Sequence (5' → 3') Amplicon (bp)
5S rRNA 5SrRNAd CCCTGGCAATAACCTACTC 112
  5SrRNArc CCCTGGTGGTTAAAGAAAAG  
16S rRNA 16SrRNAd GGCCCGAGAACGTATTCACC 288
  16SrRNArc CGAGCGCAACCCTTGTTATC  
  16SrRNAd2 GTTCCAGTGTGACCGTTCAC 295
  16SrRNArc2 CTTAGAACTAACGCTGGCAG  
23S rRNA 23SrRNAd CCTCTTAACCTTCCAGCACC 248
  23SrRNArc GGTTAGGCTATAAGGGACCG  
tRNAIle tRNAIled GATCATAGCTCAGGTGGTTAG 69
  tRNAIlerc GACCAGGATGAGTTGAACATC  
tRNAAla tRNAAlad GTTAAGGGACTCGAACCCTTG 65
  tRNAAlarc GTTTAGCTCAGTTGGCTAGAG  
flaB flaBd TCATTGCCATTGCAGATTGTG 278
  flaBrc ACCTTCTCAAGGCGGAGTTAA  
16S rRNA - tRNAAla 16SrRNArc CGAGCGCAACCCTTGTTATC 683
  tRNAAlad GTTAAGGGACTCGAACCCTTG  
tRNAAla - tRNAIle tRNAAlarc GTTTAGCTCAGTTGGCTAGAG 781
  tRNAIled GATCATAGCTCAGGTGGTTAG  
tRNAIle - 23S rRNA tRNAIlerc GACCAGGATGAGTTGAACATC 2522
  23SrRNA3'd2 CTTATTACAGACTAAGCCTAAACGTC  
23S rRNA - 5S rRNA 23SrRNArc GGTTAGGCTATAAGGGACCG 1403
  5SrRNAd CCCTGGCAATAACCTACTC  
5S rRNA - 23S rRNA 5SrRNArc CCCTGGTGGTTAAAGAAAAG 631
  23SrRNA3'd2 CTTATTACAGACTAAGCCTAAACGTC