Skip to main content

Advertisement

Table 2 Oligonucleotide primers

From: The cross-pathway control system regulates production of the secondary metabolite toxin, sirodesmin PL, in the ascomycete, Leptosphaeria maculans

Primer name Sequence (5' to 3')
E AGWGNAGWANCAWAGG
CE37 GTGTAAAGCCTGGGGTGCCTAATGAGTG
CE38 AGCTAACTCACATTAATTGCGTTGCG
CE39 CGGGGAGAGGCGGTTTG
CE40 CCCTCGAGGCCTGCATATTATTTCTACTG
CE41 TGTTTGGGGCAGGCATGTTGA
CE42 TCAGAGACAGCCAGGAGAAATCA
RT1 GTCAACAACTCGCCTTCCAT
RT2 TTAGCTTGCGGCTGAAGATT
RT2A TTGATTGACTCCACCTGGTG
RT3 GAGAAGTGGAAGAGCATCGC
RT4 TGTTCTTTGTAAGCGATGCG
RT5 TCATTTTGGTTTTCGTTTTGG
GTA7seq4 CTCGAGGCGGATGTAGAGAA
cpcAPROBEF CCCTCGGGTCTTGAACAGT
GeneRacer5' GCACGAGGACACUGACAUGGACUGA
GeneRacer5'-nested GCTGTCAACGATACGCTACGTAACG
5'cpcA1 GCGCGGGGCAAGACTTGAGTT
5'cpcA2 CGAAAGGCGCGGAACGCTAGA
GeneRacer3' CGCTACGTAACGGCATGACAGTG
GeneRacer3'-nested ATTCGCCTCAGGACTTTGTG
cpcAQF3' GTCAACAACTCGCCTTCCAT
cpcAQR3' AGAGTTGCGACGCTCAAGTT
act1F TTCCAGCTTGGAGAAGTCGT
act1R CTGACATCGACATCGCACTT
sirZFA CCAAAAGGAAGCAGGAACAA
sirZRA GCCGAGTCTGTATCCGAATG
sirPF TCACATGGTGAAATCGGCTA
sirPR AATTCCCAACGCATCAACTC
aroCF AACATTCGCTTCCAGCTCAT
aroCR TACCCTGTCGATCCTCGCT
trpCF CCGACTGTCTCGAAGTCACA
trpCR GCTTTTGCGTAGGTTCTTGC
sirZ2F CCGAATTTCCCTTCAGTCAA
sirZ1R CAATGGGTCTGGAATACGCT
cpcAPROBER CATCGCTATTGCTCTCGGAC
cpcARNAiF GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATCAGACACCATGGCACT
cpcARNAiR GGGGACCACTTTGTACAAGAAAGCTGGGTGGCTCCATGGACTGGCTACTG