Skip to main content

Table 2 Oligonucleotides used in these work

From: The replication origin of a repABC plasmid

Name Sequence
ALFAU2 5'-AGGGTACCCCGCAAAAGAAAAGA
Mal-C2Kpn 5'-TCGGTACCTTACCCAGCCCTCAAACC
RBS-C 5'-GGATCCAAGGAAACAGCTATGCAGTCGGGGAATG
repC-F1U 5'-GCGGCCGCGGATCCAATGCAGTCGGGGAATGTA
repC-F1L 5'-ACTAGTCCCGGGAACCCCGACTCCACCAGA
repC-F2U 5'-GCGGCCGCGGATCCAATGGATCGTCCGTAAGGATAG
repC-F2L 5'-ACTAGTCCCGGGGCGCGGAATTCTGCTCGC
repC-F3U 5'-GCGGCCGCGGATCCAATGGTTCCGACCCTTGAAGGG
repC-F3L 5'-ACTAGTCCCGGGGCGCGGTGCATAGTCGCT
repC-F4U 5'-GCGGCCGCGGATCCAATGGGCGTGGGAAGCTGGCGA
repC-F4L 5'-ACTAGTCCCGGGTTACCCAGCCCTCAAACC
repC-D1U 5'-GGATCCAAGGAAACAGCTATGACGCTTGCGCTCGTGC
repC-D1L 5'-GCCAAGCTTTTATATCATCGGGCCAAGC
repC-D2U 5'-GGATCCAAGGAAACAGCTATGGGAAAAGCTGCCGATA
repC-D2L 5'-GCCAAGCTTTTATAGATCCCGCAGATAG
repC-D3U 5'-GGATCCAAGGAAACAGCTATGGAACTGCTCAAGA
repC-D3L 5'-GCCAAGCTTTTATTCCAGGATGCACGCA
repCd-sSDU 5'-GAAAAGAGCTCCCTCAACGT
Cd-StopC-U 5'-GGATCCTAACAGTCGGGGAATG
Ttrack1-U 5'AGCCCGAGTCCGTGAACGAGTCCGAGCCGCGCTCCGAGAAG
  GAGCAGCACATACAGAATTCAAAACCC
Ttrack1-L 5'-CTCGAGGTTCTCCAAGCGGTTCAGCACCTCCTCGCGGAG
  CATCTCCATCTCGTTGAGCACGCTAGTGACCCCTTCAAG
Ttrack2-U 5'-ATCGAGCAGCACATCCAGAACTCCAAGCCCGAGTCCGTG
Ttrack2-L 5'-GGAGTTCTGGATGTGCTGCTCGATGTGGGCGGCGTTGGT
  GCTGATCTTCTCGGCGTTCTCGAGGTTCTCCAAGCGGTT
repCATBamU 5'-GGATCCAAGGAAACAGCTATGGACAGCACATGTGTAACG
repCATHindL 5'-AAGCTTCTAACCCGCCATGCCCACCTC
K-Syma-L 5'-GGTACCTCACGACACCCCCCGCCC
C-SymA 5'-GGATCCAAGGAAACAGCTATGGAGATTGGAAGTGTGACG
Mal-C2 5'-TCAAGCTTTTACCCAGCCCTCAAACC
AL-2U 5'-ATCGGCACAGCGTTCGGCTTTTCGTCGCCCCTC CTGGCGCGATCGGAA
1L-BU 5'-GAGAATGCTTTTGGCTTCGACCTGCTCGCACCAC TGCTGGCCCGCTCC
2L-CU 5'-GAGCAGGGGGCAAAGGCGAGCTTGGAACCGGCC AACAAGGCAAAAAGG
BL-3U 5'-GAGCGGTTAGACGGCCAAGCCATTAGCCTTCAGC CGAAGAATGAATCG
AL-2Uc 5'-CGAAAAGCCGAACGCTGTGCCGAT
1L-BUc 5'-CAGGTCGAAGCCAAAAGCATTCTC
2L-CUc 5'-CAAGCTCGGCTTTGCCCCCTGCTC
BL-3Uc 5'-AATGGCTTGGCCGTCTAACCGCTC
Cd-1086L 5'-GTTGATGAAGTTAGCCCTTTCCAG
SaU-CdL 5'-AACGCCAAGCATAGATCGTACCGT CCCCAGCATAGATCGAACCACCAC
SaL-CdU 5'-CTGTTGAGCTTCTATCCGGAGAAC GAGTTGCGTCAGGATGCACAATTG
Cs-1087U 5'-CTGGAAAGGGCTAACTTCATCAA CTCTGCTGGCGGCTATCTGCGCGAT