Skip to main content

Table 5 Sequences of the primers used for the construction of a full-length cDNA clone and mutants of FMDV Asia1/JSp1c8

From: In-vitro and in-vivo phenotype of type Asia 1 foot-and-mouth disease viruses utilizing two non-RGD receptor recognition sites

Name Nucleotide Sequence (5'→3') Nucleotide Position (nt)
E1 CAGGATCC TAATACGACTCACTATAGGGTTGAAAAGG GGCGCTAGGGTC 1-21
E1' TAAAACTTAGGGGGGGGGGGGGGGGGGGGTGAAAG 361-390
E2 TTTCACCCCCCCCCCCCCCCCCCCCTAAGTTTTAC 362-391
E2' CCTCTAGA CCTGGAAAGACCAGGC 677-700
E3 AGGTCTAGAGGGGTGACATTTTGT 690-713
E3' GTCTGCAGCAGAAAGGTAAGGGAT 3078-3101
E4 CTGCTGCAGACTATGCTTACACTG 3090-3113
E4' AAAGAATTC AATTGCTGCCTCATG 5414-5437
E5 AATTGAATTCTTTGAGGGAATGGTGCAC 5425-5452
E5' TTGCGGCCGCTTT(38) 3'end
P1 ACAAGGAAAGATGGAGCTCACACTTCACAAC 1168-1198
P1' GTTGTGAAGTGTGAGCTCCATCTTTCCTTGT 1168-1198
TR1 ACTGCATTCATTCTGAGTGGGA 2960-2984
TR1' GGCAAGATCACCACGCCGCGAGGA 3679-3703(D→G)
TR2 TCCTCGCGGCGTGGTGATCTTGCC 3679-3703(D→G)
TR2' 5'-GAAGAAACTCGAGGCGACTTTGAC-3' 4342-4366
TR3 TCCTCGCGGCGTAGTGATCTTGCC 3679-3703(D→S)
TR3' GGCAAGATCACTACGCCGCGAGGA 3679-3703(D→S)
  1. Nucleotide positions of primers used for cloning are shown: numbering according to Asia1/JS/CHA/05 (Genbank Accession: EF149009). T7 promoter sequences are marked with italic type, the restriction sites are highlighted by underlining, silent mutations within the viral sequence are underlined and amino acid changes are shown in brackets.