Skip to main content

Advertisement

Table 1 Primers and probes designed for the GeneDisc® assay

From: A multiplex real-time PCR assay targeting virulence and resistance genes in Salmonella entericaserotype Typhimurium

Target sequence Forward primer, reverse primer and probe sequences (5'-3') GenBank accession number Location within sequence
DT104 GGACCTGGCTGAGTTTATTTCG   1370 - 1391
16S-23S GCATCGGCTGTGAGACCAA* AF275268 1438 - 1420
spacera FAM-TGGTTTCTGAAAGCGGAGCTAATGCG-BHQ   1393 - 1418
  TCTGCTGAGCGACAACAGATTT   1498146 - 1498167
ssaQ b TGGCACCAGCCTGAATATACAG* AE006468 1498213 - 1498192
  ROX-TCCTGCCCCTCCTGTGGTAGT -BHQ   1498169 - 1498189
  AAGAGGCCGCGATCTGTTTA*   3964669 - 3964650
mgtC c CGAATTTCTTTATAGCCCTGTTCCT AE006468 3964600 - 3964624
  ROX-AAGGGTTAGGTTCGGTCCCCG-BHQ *   3964648 - 3964628
  CGGCGGACTTACTTTTTGAAA   4482051 - 4482071
spi4_D d TGGTCACGGTATTTGGGTAATATTT* AE006468 4482132 - 4482108
  ROX-CCAAAAGTAAGGACTATGCTGGCCG-BHQ   4482077 - 4482101
  CTTATGAGGGAAAGGGCG*   1179300 - 1179283
sopB e ATGCACACTCACCGTGG AE006468 1179215 - 1179231
  ROX-TTGGGATACCAAGAATATTCATCACGCC-BHQ*   1179275 - 1179248
  AATGAACTACGAAGTGGGCG*   24307 - 24288
spvC f TCAAACGATAAAACGGTTCCTC FN432031 24232 - 24253
  FAM-ATGGTGGCGAAATGCAGAGACAGGC -BHQ*   24285 - 24261
  GGATTTTCTCCAGCTTCTGT   132 - 151
Left junction of SGI1g CTAACCATAAGAGAACTTCC* AF261825 263 - 244
  FAM-TAAATCTCCTAAATTAAATTAAAACGAAGTAAAACC -BHQ   161 - 197
  TGGGCAGCAGCGAAGTC*   27686 - 27670
intI1 h TGCGTGGAGACCGAAACC AF261825 27617 - 27634
  FAM-AGGCATTTCTGTCCTGGCTGGCG-BHQ*   27668 - 27646
  CTGGATCTCAACAGCGG   270 - 286
bla TEM i CAACACGGGATAATACCGC* AJ634602 378 - 360
  FAM- AGATCCTTGAGAGTTTTCGCCCCG-BHQ   289 - 312
  TCCTGACCCTGCGCTCTATC   29611 - 29630
sul1 j TGCGCTGAGTGCATAACCA* AF261825 29679 - 29661
  ROX-ATTGCTGAGGCGGACTGCAGGC -BHQ   29636 - 29657
  1. FAM = 6-carboxylfluorescein; ROX = carboxy-X-rhodamine; BHQ = Black Hole Quencher. * complementary strand; a:marker of the phage type DT104 located in the 16S-to-23S spacer region of bacterial rRNA genes [4]; b: gene encoding SsaQ; c: gene encoding MgtC; d: gene encoding Spi4_D; e: gene encoding SopB; f: gene encoding SpvC; g: marker of the SGI1 left junction which is composed of the end of the thdF gene and the intergenic sequence between thdF and int genes [8]; h: marker targeting the gene encoding the integrase of the class 1 integron inside SGI1; i: gene encoding beta-lactam resistance; j:gene encoding sulphonamide resistance.