Skip to main content

Advertisement

Table 10 Primers and probes for real-time PCR detection of virulence genes developed for this study

From: Virulence gene profiling of enterohemorrhagic (EHEC) and enteropathogenic (EPEC) Escherichia coli strains: a basis for molecular risk assessment of typical and atypical EPEC strains

Target genea Forward primer, reverse primer and probe sequences (5'-3') Location within sequences Gene Bank accession no.
nleG6-2 (Z2150) ATATGCTCTCTATATGATAAGGATG 1928877-1928901 AE005174
  AAAGTGACATTCGTCTTTTCTCATA 1928996-1928872  
  [6FAM]CGTTAGTGCAACTTGTTGAAACTGGTGGAA[BHQ1] 1928902-1928931  
nleG5-2 (Z2151) AGACTATTCGTGGAGAAGCTCAAG 1929199-1929222 AE005174
  TATTGAAGGCCAATCTGGATG 1929337-1929317  
  [6FAM]TGGATATTTTATGGGAAGTCTTAACCAGGATGG[BHQ1] 1929269-1929301  
espK ATTGTAACTGATGTTATTTCGTTTGG 1673295-1673320 AE005174
  GRCATCAAAAGCGAAATCACACC 1673419-1673397  
  [6FAM]CAGATACTCAATATCACAATCTTTGATATATAAACGACC[BHQ1] 1673330-1673368  
bfpA CCAGTCTGCGTCTGATTCCA 2756-2775 FM180569
  CGTTGCGCTCATTACTTCTGAA 2816-2795  
  TAAGTCGCAGAATGC-MGB 2777-2791  
  1. a) Z2150 and Z2151 derive from OI-57 [24]