Skip to main content

Table 1 Description and specificity of oligonucleotide probes

From: Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

Probe Target sequence (5' to 3')a Label Positionb Target bacteriac Formamide concentrationd Source
LGC358a CCATTGTGGAAGATTCCCT Cy3 358-76 Most lactobacilli 25-30 [13], modified
LGC358b-comp CCATTGCGGAAGATTCCCT - 358-76 Competitor probe for LGC358a:
Staphylococci, Gemella, Granulicatella, Abiotrophia
25-30 [13], modified
LAB759 CTACCCATRCTTTCGAGCC Cy3, FAM 759-77 Most lactobacilli without L. salivarius group 30-35 [8]
LAB759-comp CTACCCACGCTTTCGAGCM - 759-77 Competitor probe for LAB759:
Many streptococci, β-Proteobacteria, but no lactobacilli
30-35 this study
L-Lbre466-2 ACCGT CAACCCTTG AACAG Cy3 466-84 L. brevis 30-55 this study
L-Lbuc438-2 CACCYG TTCTTCT CCAACA FAM 439-57 L. buchneri (L. hilgardii, L. kefiri, L. parabuchneri) 50-55 this study
Lcas467 CCGTCACGCCGACAACAG Cy3, FAM 467-84 L. casei, L. paracasei subsp. paracasei, L. rhamnosus, L. zeae 25-40 this study
L-Lcol732-2 GTTGCAAGCT AGACAG CC Cy3 732-49 L. coleohominis, L. reuteri (some strains) ≥30 this study
Lfer466 CCGTCAACGTATGAACAG Cy3 466-83 L. fermentum 25 this study
Lfer466-H448 TTACTCTCATACGTGTTC - 448-65 Helper probe for Lfer466 25 this study
Lfer466-H484 GCCGTGACTTTCTGGTTAAATA - 484-505 Helper probe for Lfer466 25 this study
Lgas183 GACATGCGTCTAGTGTTG FAM 183-200 L. gasserii, L. johnsonii 25-30 this study
Lgas458 ATAAAGGCCAGTTACTACC FAM 458-76 L. acidophilus L. crispatus, L. gasserii, L. jensenii, L. johnsonii (L. amylolyticus, L. amylovorus, L. fornicalis, L. hamsteri, L. helveticus, L. kefiranofaciens, L. kitasatonis) 25 this study
Lpla759 CTACCCATACTTTCGAGCC FAM 759-77 L. paraplantarum, L. plantarum, L. pentosus 20-30 this study
Lpla990 ATCTCTTAGATTTGCATAGTATG Cy3 990-1012 L. paraplantarum, L. plantarum, L. pentosus 20-35 this study
Lpla990-H1018 CCCGAAGGGAACGTCTA - 1018-34 Helper probe for Lpla990 20-35 this study
Lreu986 GCGCAAGATGTCAAGACC Cy3, FAM 986-1004 L. coleohominis, L. fermentum, L. oris, L. reuterii, L. vaginalis(L. frumenti, L. gastricus, L. ingluviei, L. mucosae, L. panis, L. pontis, L. suebicus) 25-30 this study
Lreu986-H967 TGGTAAGGTTCTTCGCGTA - 967-85 Helper probe for Lreu986 25-30 this study
Lsal574 AAAGACCGCCTGCGTTCCC Cy3, FAM 574-92 L. salivarius (L. acipiscis, L. animalis, L. apodemi, L. murinus, L. ruminis, L. satsumensis, L. vini) 35-50 this study
L-Lsal1113-2 CTGG CAACTG ACAACAAG FAM 1113-30 L. salivarius (L. agilis, L. equi, L. saerimneri) 35-45 this study
Lvag222 ACCGCGGGCCCATCCTGA Cy3 222-39 L. vaginalis 35-50 this study
STR405 TAGCCGTCCCTTTCTGGT Cy3 405-22 Streptococci ≤ 50 [10, 38]
LGC358c CCATTGCCGAAGATTCCCT FAM 358-76 Streptococci 25-30 [13], modified
MIT447 CACYCGTTCTTCTCTTACA FAM 447-65 Mitis group of streptococci 25 [10, 38]
MUT590 ACTCCAGACTTTCCTGAC Cy3 590-607 Streptococcus mutans 30 [10, 38]
L-Ssob440-2 CACACG TTCTTCCCCT AC FAM 440-57 Streptococcus sobrinus 45 this study
L-Sco/int172-2 CAGTAAATGTTCTT ATGCG GTA Cy3, FAM 172-93 Streptococcus constellatus, S. intermedius 40-55 [39]
ABI161 TGCGGTTTTAGCATCCGT Cy3 161-78 Granulicatella adjacens, G. elegans ≤ 30 this study
ABI1246 AGTTCGCTGCTCGTTGTA Cy3 1246-63 Abiotrophia defectiva, Granulicatella adjacens, G. elegans, L. coleohominis (Facklamia hominis, F. languida, F. miroungae) ≤ 35 this study
LCC1030 CCTGTATCCCGTGTCCCG Cy3, FAM 1030-47 Lactococcus lactis, L. garvieae 40-55 this study
EUB338 GCTGCCTCCCGTAGGAGT Cy3, FAM 338-55 Most Eubacteria ≤ 50 [40]
  1. a Bold printed bases indicate the position of locked-nucleic-acids.
  2. b 16S rRNA target position (Escherichia coli numbering).
  3. c Taxa in parentheses are detected by the probe but have not been described to colonize the human oral cavity [11].
  4. d Optimum formamide concentration in hybridization buffer.