Skip to main content

Table 1 Melt-MAMA primers targeting informative canSNPs

From: Phylogeography of Francisella tularensis subspecies holarctica from the country of Georgia

SNP SCHU S4 position Genome SNP state (D/A)a Melt MAMA primerc Melt-MAMA primer sequencesd Primer conc. (μM) Annealing temp. (°C) Melting Tm (°C)
B.Br.026 1484645 A/C D GAAACTTATTTGTTCCTAAGACAGTGACAcTA 0.800 55 73.1
    A ggggcggggcggggcAAACTTATTTGTTCCTAAGACAGTGACAgTC 0.200   79.7
    C GCATTGAGTTTGACAGGGTTGC 0.200   
B.Br.027 1329722 T/Gb D ggggcggggcggggcggggcCATGCCAGGCACTACAATTGATAGTaTA 0.200 55 78.2
    A TGCCAGGCACTACAATTGATAGTtTC 1.000   73.6
    C TATACTTCTGACCATGGCGTTCAAAT 0.200   
B.Br.028 212729 T/G D ggggcggggcggggcggggcAAATTAGTTCAAATGTTAAATTTGATcCT 0.200 55 75.8
    A AAATTAGTTCAAATGTTAAATTTGATaCG 0.200   67.7
    C CAAAATAAATCCCGTTGAGAATAGAA 0.200   
B.Br.029 1185519 A/G D ggggcggggcggggcggggcTGCTTAATCTCATTGACTAGCTGTGgTA 0.200 55 78
    A TGCTTAATCTCATTGACTAGCTGTGaTG 1.000   70
    C ACAAAGTTGAAACTATCGAGCATAAATC 0.200   
B.Br.030 928335 T/G D ggggcggggcggggcggggcTGTTGGGTCAAAGAGAGAAGTgTT 0.200 55 78.2
    A ATTGTTGGGTCAAAGAGAGAAGTaTG 0.200   70
    C GCCACCAAAGAATACAGAGTAGTCAT 0.200   
B.Br.031 1634565 A/G D ggggcggggcggggcggggcGCACCAATCGTATCTAATTGATcCA 0.400 55 79
    A GCACCAATCGTATCTAATTGATtCG 0.200   70
    C AACTTTGCTAAAACAAATGCTGTTGC 0.200   
B.Br.032 283540 A/Gb D ggggcggggcggggcggggcTGCTAAACCTACAGTAATCAGAAGTATtAT 0.200 55 72
    A TGCTAAACCTACAGTAATCAGAAGTATcAC 0.600   68.4
    C GCTAAATTTTAGTAAGATAAAAAGTGTAAGTAGTG 0.200   
  1. aSNP states are presented according to their orientation in the SCHU S4 reference genome (NC_006570);
  2. bAssays designed from the reverse complement of the reference sequence.
  3. cD: Derived; A: Ancestral; C: Common Primer
  4. dPrimer tails and antepenultimate mismatch bases are in lower case