Skip to main content

Advertisement

Table 2 Primers used to determine CTX prophage array structure

From: New V. choleraeatypical El Tor variant emerged during the 2006 epidemic outbreak in Angola

Primer Nucleotide sequence (5' to 3') Position (GenBank Accession no. NC_002505-6)
tlcF CCAAAACAACAGAAGCAACAGAGCAACG 1574460-1574487
rstCF GGCGCTTATACAGACGAAATCGCTC 1564180-1564201
rstCR AGCGCCTGAACGCAGATATAAA 1564290-1564311
rstAR CGACAAAAACAAACGGAGAAGCGT 1572748-1572771
ctxAF CTCAGACGGGATTTGTTAGGCACG 1567895-1567918
rtxR CAAGCTGCGATCAGCATGGCGTGGTC 1563652-1563671
cepR CAGTGTTTTGGTGACTTCCGT 1571101-1571121
chr2F CTCACGCTGAACAGCAAGTC 507564-507583
chr2R AAACCGGGAGAAGTGATTGC 509487-509506