Skip to main content

Table 1 Bacterial strains, plasmids, and primers used in this study

From: Staphylococcus aureus requires cardiolipin for survival under conditions of high salinity

Strain or plasmid Relevant characteristics Source/reference
S. aureus strain   
   RN4220 8325-4 derivative that accept foreign DNA [55]
   R cls1 RN4220 ΔSA1155; Cmr This study
   R cls2 RN4220 ΔSA1891; Tetr This study
   R cls1/cls2 RN4220 ΔSA1155/ ΔSA1891; Cmr Tetr This study
   N315 pre-methicillin resistant strain [56]
   N cls1 N315 ΔSA1155; Cmr This study
   N cls2 N315 ΔSA1891; Tetr This study
   N cls1/cls2 N315 ΔSA1155/ ΔSA1891; Cmr Tetr This study
   8325-4 NCTC 8325 cured of prophages, rsbU(-) [57]
   8 cls1 8325-4 ΔSA1155; Cmr This study
   8 cls2 8325-4 ΔSA1891; Tetr This study
   8 cls1/cls2 8325-4 ΔSA1155/ ΔSA1891; Cmr Tetr This study
   SH1000 8325-4 derivative, rsbU repaired, rsbU(+) [58]
   S cls1 SH1000 ΔSA1155; Cmr This study
   S cls2 SH1000 ΔSA1891; Tetr This study
   S cls1/cls2 SH1000 ΔSA1155/ ΔSA1891; Cmr Tetr This study
   MT01 isolate from healthy host, able to generate L-form This study
   MT01 cls1 MT01 ΔSA1155; Cmr This study
   MT01 cls2 MT01 ΔSA1891; Tetr This study
   MT01 cls1/cls2 MT01 ΔSA1155/ ΔSA1891; Cmr Tetr This study
plasmids   
   pMAD thermosensitive, pE194ts-based delivery vector [53]
   pMADcat1155 pMAD-based SA1155 targeting vector This study
   pMADtet1891 pMAD-based SA1891 targeting vector This study
   pHY300PLK shuttle vector, tet (TetR) Takara, Japan
   pRIT5H shuttle vector, cm(CmR) [54]
primers 5'-3'  
   Tet-F(Sal) CATATTGTCGAC TAAGTGATGAAATACTG  
   Tet-R(EcoRI) GGAATTC CTGTTATAAAAAAAGGATCAAT  
   CAT(Sal)F CGAGTCGAC GATAAAGTGGGATATTTT  
   CAT(Eco)R CGAATTC CGGGGCAGGTTAGTGACATT  
   clsU1p TGGATCC TGATATTGCTTACATACT  
   clsU2p TGGGTCGAC AAAAAGTACAAATAGC  
   clsD1p CACAGATCT TATGGACTTTAGAAGTT  
   clsD2p TTTAGATCT CAATATCATCCAAATTA  
   1891U1 CGGATCC AATAGTCCGACGATAGCT  
   1891U2 GAAGTCGAC GTCCTAATAGTAAGTA  
   1891D1 TGAATTC ACAAAAGCACGTTATGCT  
   1891D2 TGAAGATCT AACATCACAACGGCATA  
  1. Cm: chloramphenicol, Tet: tetracycline