Skip to main content

Table 3 Oligonucleotide primers used in this study

From: SO2426 is a positive regulator of siderophore expression in Shewanella oneidensisMR-1

Primer DNA sequence (5' → 3') Reference or source
klh001 TTCGTCGTTGTAGTGAACC This study
klh004 TGCCGTGTAAGTCATTCC This study
2426F ATGATATTGATTCTCGTTTGGT This study
2426R TTAAGCGCTAAAACTGTATCCTTG This study
2426shF ATGAGTAGAATACTGTTAGTCGAT This study
2426shR TTAAGCGCTAAAACTGTATCC This study