Skip to main content

Table 4 Primers used in this study (R = A+G, K = T+G, Y = C+T)

From: Study of polymorphisms in tir, eae and tccP2 genes in enterohaemorrhagic and enteropathogenic Escherichia coli of serogroup O26

Primer name Sequence (5' to 3') Target gene Annealing temp. (°C) Amplicon size (bp) Reference
B52 AGGCTTCGTCACAGTTG eaeA 50 570 [39]
B53 CCATCGTCACCAGAGGA     
B54 AGAGCGATGTTACGGTTTG stx1 50 388 [39]
B55 TTGCCCCCAGAGTGGATG     
B56 TGGGTTTTTCTTCGGTATC stx2 50 807 [39]
B57 GACATTCTGGTTGACTCTCTT     
wzx-wzyO26-F AAATTAGAAGCGCGTTCATC wzx O26 56 596 [41]
wzx-wzyO26-R CCCAGCAAGCCAATTATGACT     
fliC-H11-F ACTGTTAACGTAGATAGC fliC H11 56 224 [41]
fliC-H11-R TCAATTTCTGCAGAATATAC     
B139 CRCCKCCAYTACCTTCACA tir β 53 560 [27]
B140 GATTTTTCCCTCGCCACTA     
tir(591-1617)-F TCCAAATAGTGGCGAGGGAA tir β 54 1026 This study
tir(591-1617)-R TTAAACGAAACGTGCGGGTC     
B73 TACTGAGATTAAGGCTGATAA eae β 50 520 [27]
B137 TGTATGTCGCACTCTGATT     
eae(37-1142)-F CGGCACAAGCATAAGCTAAA eae β 51 1105 This study
eae(37-1142)-R AGTTTACACCAACGGTCGCC     
eae(1001-2046)-F TCCGCTTTAATGGCTATTTACC eae β 50 1045 This study
eae(1001-2046)-R TGCCTTCGCTGTTGTTTTAT     
eae(2319-2972)-F GGCTCTGCAAAGAACTGGTT eae β 50 653 This study
eae(2319-2972)-R AGTCTCTATCAAACAAGGATACACG     
tccP2-F ATGATAAATAGCATTAATTCTTT tccP2 56 753 [24]
tccP2-R TCACGAGCGCTTAGATGTATTAAT