Skip to main content

Advertisement

Table 5 PCR primers and probes used in the species-specific real-time PCR assays

From: Rapid identification and quantification of Campylobacter coli and Campylobacter jejuniby real-time PCR in pure cultures and in complex samples

Primer or Probea Nucleotide sequence 5'-3' Location within target Origin Target Gene detectedb
glyA-F forward F: AAACCAAAGCTTATCGTGTGC 297-320 This study  
glyA-R reverse R: AGTGCAGCAATGTGTGCAATG 422-359 Lagier et al. (2004) Campylobacter coli glyA gene (125 bp)
glyA-P MGB Probe P: FAM-CAACTTCATCCGCAAT 346-330 This study  
hipO-F forward F: CTTGCGGTCATGCTGGACATAC 340-360 This study  
hipO-R reverse R: AGCACCACCCAAACCCTCTTCA 464-444 This study Campylobacter jejuni hipO gene (124 bp)
hipO-P MGB Probe P: VIC-ATTGCTTGCTGCAAAGT 424-409 This study  
  1. bp, length in base pairs of the species specific PCR products
  2. aPrimers and probes were designed by using the program Primer Express version 2.0 (Applied Biosystems, Foster city, CA, USA). The TaqMan® MGB probes were dual-labelled with either fluorescent reporter dyes FAM (6-carboxyfluorescein, C. coli specific probe) or VIC (C. jejuni specific probe) on the 5'end, and quenched by a non fluorescent quencher associated with a minor groove binder at the 3'end (Applied Biosystems).
  3. bThe nucleotide sequences were retrieved from the GenBank™ sequence database http://www.ncbi.nlm.nih.gov/Genbank/index.html under accession numbers: [GenBank: Z36940] for C. jejuni hipO gene and [GenBank: AF136494] for C. coli glyA gene.