Rapid identification and quantification of Campylobacter coli and Campylobacter jejuniby real-time PCR in pure cultures and in complex samples

Table 5 PCR primers and probes used in the species-specific real-time PCR assays

Primer or Probe^a	Nucleotide sequence 5'-3'	Location within target	Origin	Target Gene detected^b
glyA-F forward	F: AAACCAAAGCTTATCGTGTGC	297-320	This study
glyA-R reverse	R: AGTGCAGCAATGTGTGCAATG	422-359	Lagier et al. (2004)	Campylobacter coli glyA gene (125 bp)
glyA-P MGB Probe	P: FAM-CAACTTCATCCGCAAT	346-330	This study
hipO-F forward	F: CTTGCGGTCATGCTGGACATAC	340-360	This study
hipO-R reverse	R: AGCACCACCCAAACCCTCTTCA	464-444	This study	Campylobacter jejuni hipO gene (124 bp)
hipO-P MGB Probe	P: VIC-ATTGCTTGCTGCAAAGT	424-409	This study

bp, length in base pairs of the species specific PCR products
^aPrimers and probes were designed by using the program Primer Express version 2.0 (Applied Biosystems, Foster city, CA, USA). The TaqMan^® MGB probes were dual-labelled with either fluorescent reporter dyes FAM (6-carboxyfluorescein, C. coli specific probe) or VIC (C. jejuni specific probe) on the 5'end, and quenched by a non fluorescent quencher associated with a minor groove binder at the 3'end (Applied Biosystems).
^bThe nucleotide sequences were retrieved from the GenBank™ sequence database http://www.ncbi.nlm.nih.gov/Genbank/index.html under accession numbers: [GenBank: Z36940] for C. jejuni hipO gene and [GenBank: AF136494] for C. coli glyA gene.

ISSN: 1471-2180