Skip to main content


Table 6 Primers used for MLST

From: Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

Locus Putative function Locationa Forward primer Reverse primer Length (bp)
dapE Succinyl diaminopimelate desuccinylase 301,402-302,538 GTAAATATTGATTCGACTAATG CACTAGCACTTGTTTCACTG 669
hisJ Histidinol phosphate phosphatase 606,408-607,235 TCCACATGGTACGCATGAT GGACATGTCAAAATGAAAGATC 714
sigB Stess responsive alternative sigma factor B 924,734-925,513 CCAAAAGTATCTCAACCTGAT CATGCATTTGTGATATATCGA 642
ribC Riboflavin kinaseand FAD synthase 1,364,536-1,365,480 AAGACGATATACTTACATCAT GTCTTTTTCTAACTGAGCA 633
purM Phosphoribosyl aminoimidazole synthase 1,893,107-1,894,153 CAAGCTCCACTTTGACAGCTAA TAAAGCAGGCGTGGACGTA 693
betL Glycine betaine transporter 2,216,882-2,218,405 ACAGAACATTATCCAAATGAGTT ACGTTGTGATTTTTTCGGTC 534
gap Glyceraldehyde 3-phosphate dehydrogenase 2,578,558-2,579,584 CTGGATCAGAAGCTGCTTCCA GTCGTATTCAAAATGTGGAAGGA 621
tuf Translation elongation factor 2,816,958-2,818,145 CATTTCTACTCCAGTTACTACT GCTCTAAACCCCATGTTA 681
Subtotal      5,844
  1. a, Positions correspond to complete genome sequence of L. innocua strain CLIP11262 (AL592022).