Skip to main content

Table 1 Primers used in study.

From: Genetic analysis of the Staphylococcus epidermidis Macromolecular Synthesis Operon: Serp1129 is an ATP binding protein and sigA transcription is regulated by both σA- and σB-dependent promoters

Primer Number 5'-3' Sequence Description
942 GCATTTGAAGCGGGTTTGTTATC Forward dnaG
943 ATTGACTAAAGAAAGGTCTC Reverse dnaG
1035 GGCTATACTCACGATGTCTGG Forward serp1130/RT-PCR primer
1036 TTTATATTATCCATGTACTTACCACC Reverse serp1130
670 ACATGTGTTTATTTACTTTTCAACCCGC RT-PCR primer
672 ATTGTTGCCTCTGATTCAATTGGTG Forward serp1129/RT-PCR primer
673 TGCATATCTAGCTTTGTCACCTAATCC Reverse serp1129/RT-PCR primer
675 TTTAACAATTCGTATGCTGCATGG Reverse sigA
760 CTTGCTTTCGAATAAATTTACGTGC RT-PCR primer
674 AAGCAAACAATTGATCCGACTTTAACAC RT-PCR primer/forward sigA
677 GGATTTTATATCACGCAGTGCTTCTAAC RT-PCR primer
940 ATTATTATCAAAAAATTGTGCC RT-PCR primer
1135 TTTAAATACATACGCACTGGGTC RT-PCR primer
1178 CATCGTGAGTATAGCCAAGTCAGGACG Primer extension 5' end
1196 TCAGCTATATGCTCGCCCGTGATAG Primer extension 5' end
1194 CTTGGTTGTCAGACATGAAAAGGCCT Primer extension 3' end
1211 AGGTGTTTTTGATGTTCTTGAAATGCC Primer extension
1212 TTCGATAACAATTCCATTAGTGGACCC Primer extension
1213 GATTTGCAGCATAAATAACGAGTTCCTG Primer extension
1214 ATCTTCTAAAAAGATGGTACATATAGC Primer extension
1215 ATCTATACGCAAAAGACATCACCTATC Primer extension
1222 AAGTGATATTACCTTAAATAAGCGG Primer extension 3' end
1224 AATCACTAGATTACACTGAGTAAGTG Primer extension 3' end
1319 TAATTCTGAATCTCCAATACG GSP*1 at 3' end of dnaG for 5' RACE
1320 TTTGAATATAGTCCTCTATTTCG GSP*2 at 3' end of dnaG for 5' RACE
1321 TAACTAAATCTAATATATCAG GSP*1 at 5' end of dnaG for 5' RACE
1322 TTTATTTCATCAATGACGGATTG GSP*2 at 5' end of dnaG GSP2 for 5' RACE
731 GTAAGTCCATGG CATGGATAATATAAAGATAATTG Forward serp1129 cloning primer with NcoI site
732 GATCAGGATCC GGTTGCTAAAAGAATGAAGG Reverse serp1129 cloning primer with BamHI site
  1. *GSP = Gene specific primer
  2. Italics in primers 731 and 732 represent the Nco I and Bam HI restriction sites, respectively.