Skip to main content

Table 1 Endpoint and real-time PCR primers employed in this study

From: Strategies of Nitrosomonas europaea 19718 to counter low dissolved oxygen and high nitrite concentrations

Primer Sequence (5'-3') Position Target gene Reference
Endpoint PCR
A189
amoA2R'
GGHGACTGGGAYTTCTGG
CCTCKGSAAAGCCTTCTTC
151-168
802-820
amoA [36, 37]
HAO1F
HAO1R
TCAACATAGGCACGGTTCATCGGA
ATTTGCCGAACGTGAATCGGAACG
203-226
1082-1105
hao [38]
NirK1F
NirK1R
TGCTTCCGGATCAGCGTCATTAGT
AGTTGAAACCGATGTGGCCTACGA
31-54
809-832
nirK [38]
NorB1F
NorB1R
CGGCACTGATGTTCCTGTTTGCTT
AGCAACCGCATCCAGTAGAACAGA
479-502
1215-1238
norB [38]
KNO50F
KNO51R
TNANACATGCAAGTCGAICG
GGYTACCTTGTTACGACTT
49-68
1492-1510
Eubacterial 16S rRNA gene [39]
Quantitative PCR
amoAFq
amoARq
GGACTTCACGCTGTATCTG
GTGCCTTCTACAACGATTGG
408-426
524-543
amoA [15]
HAO1Fq
HAO1Rq
TGAGCCAGTCCAACGTGCAT
AAGGCAACAACCCTGCCTCA
266-285
331-350
hao [38]
NirK1Fq
NirK1Rq
TGCAGGGCATACTGGACGTT
AGGTGAACGGGTGCGCATTT
182-201
291-310
nirK [38]
NorB1Fq
NorB1Rq
ACACAAATCACTGCCGCCCA
TGCAGTACACCGGCAAAGGT
958-977
1138-1157
norB [38]
EUBF
EUBR
TCCTACGGGAGGCAGCAGT
GGACTACCAGGGTATCTAATCCTGTT
339-357
780-805
Eubacterial 16S rRNA gene [34]