Skip to main content

Advertisement

Table 1 Primers used for detection of E. coli molecular markers

From: Diarrhea-associated biofilm formed by enteroaggregative Escherichia coli and aggregative Citrobacter freundii: a consortium mediated by putative F pili

Gene Locus description Primer sequence (5'-3') Amplicon length (bp) Annealing temperature (°C) Reference
Enteroaggregative E. coli markers
aat AA probe (CVD432) CTGGCGAAAGACTGTATCAT 630 55-60 [9]
   CCATGTATAGAAATCCGCTGTT    
aggR Transcriptional activator CTAATTGTACAATCGATGTA 324 50 This study
   CTGAAGTAATTCTTGAAT    
aggA Aggregative fimbria I (AAF I) GCTAACGCTGCGTTAGAAAGACC 421 55-60 [9]
   GGAGTATCATTCTATATTCGCC    
aafA AAF/II GACAACCGCAACGCTGCGCTG 233 50 [9]
   GATAGCCGGTGTAATTGAGCC    
agg3A AAF/III GTATCATTGCGAGTCTGGTATTCAG 462 60 [5]
   GGGCTGTTATAGAGTAACTTCCAG    
pilS Type IV pilus ATGAGCGTCATAACCTGTTC 532 58 [14]
   CTGTTGGTTTCCAGTTTGAT    
pic Mucinase TTCAGCGGAAAGACGAA 500 55-60 [9]
   TCTGCGCATTCATACCA    
pet Plasmid-encoded toxin CCGCAAATGGAGCTGCAAC 1,133 55-60 [9]
   CGAGTTTTCCGCCGTTTTC    
astA EAEC heat-stable toxin CCATCAACACAGTATATCCGA 111 55-60 [9]
   GGTCGCGAGTGACGGCTTTGT    
Enteropathogenic E. coli markers
EAF probe EPEC adhesion factor CAGGGTAAAAGAAAGATGATAA 396 52 [9]
   TATGGGGACCATGTATTATCA    
eae Intimin (adhesin) CCCGAATTCGGCACAAGCATAAGC 877 52 [9]
   CCCGGATCCGTCTCGCCAGTATTCG    
escC Locus of enterocyte effacement (LEE) 2 GTCAGCGACAGATATAACATAC 450 54 [44]
   AACGCATTCACCCTAATC    
escV LEE 3 CTAACTTCTTTCCCCACAATC 760 54 [44]
   TATCCCCAACAGGCAAAC    
Enterohaemorrhagic E.coli markers
stx Shiga toxin I and II TTTACGATAGACTTCTCGAC 227 48 [45]
   CACATATAAATTATTTCGCTC    
hlyA hemolysin GGTGCAGCAGAAAAAGTTGTAG 1,551 57 [46]
   TCTCGCCTGATAGTGTTTGGTA    
Enterotoxigenic E. coli markers
cfaA-B Colonization factor antigen 1 CTATTGGTGCAATGGCTCTGACC 352 55-60 [47]
   GCAGCAGCTTCAAATTCTTTGGC    
cs3 Colonization factor CS3 CCACTCTAACCAAAGAACTGGC 250 60 This study
   GGTGGTGGCAAAGCTAGCAGAG    
ltA Heat-labile enterotoxin GGCGACAGATTATACCGTGC 696 50 This study
   CCGAATTCTGTTATATATGTC    
estA Heat-stable enterotoxin CAGGATGCTAAACCAGTAGAGT 174 60 This study
   TCCCTTTATATTATTAATAGCACCC    
Uropathogenic E. coli markers
papC P pili usher GACGGCTGTACTGCAGGGTGTGGCG 328 60 [48]
   ATATCCTTTCTGCAGGGATGCAATA    
sfaD-E S fimbria CTCCGGAGAACTGGGTGCATCTTAC 407 60 [48]
   CGGAGGAGTAATTACAAACCTGGCA