Skip to main content

Table 2 Base sequences at orfs of Φ2954

From: Characterization of Φ2954, a newly isolated bacteriophage containing three dsRNA genomic segments

gene sequence
1 UAGGAAGUUUGAACCAUGGCUAGAAGAAUC
2 GCCGAGUGGCUCCGAAUG AAGGAUGACACU
3 UGCCAAGGGGUUAAUAUG UCAACCGCUCU
4 UCAAGGAAACCUUGUsAUG AAGAUGUUACCG
5 GCCGGUUAAUCCGCGGUG AGCAAACAAGGC
6 CGACGACUCGGGAGUAUG CAACAGUAUCUG
7 GUAUGGGAGUGUAAAAUG GAUCUUAUUAAA
8 AACAAGGAGCAAGAAAUG GCUAAGCCACCC
9 UGGCAGGAGAUUCAUAUG UUCGCTAAAAGC
10 CGUAGUAGUGAAACCAUG AAUAAAGTTCTG
16 CUUCGGGUUGAGCACAUG GCCCAUGCCAGA
12 AACAUCGCCGCUCUGAUG GGUGCUGUAAAC
14 AGAGGUGUUUUCGAUAUG UUGAAAGUUCAG
15 CAUGAGGUCUUGCGAAUG AACACUUAUCAA