Skip to main content

Table 1 Bacterial strains, plasmids and oligonucleotides used in this study.

From: The ClpP protease homologue is required for the transmission traits and cell division of the pathogen Legionella pneumophila

Strain, plasmid or primer Phenotype, genotype or sequence Reference or source
E . coli strains   
DH5α F- endA1 hsdRI7 (rk - mk +) supE44 thi-1 λ- recA1 gyrA96 (Nalr) relA1 Δ (lacZYA-argF)U169 deoR φ 80dlacZ Δ M15 Lab collection
DH5αλpir DH5α transduced with λpir [69]
L. pneumophila strains   
JR32 Virulent L. pneumophila serogroup 1, strain Philadelphia, salt-sensitive isolate of AM511 [43]
LpΔclpP JR32 with clpP deletion This study
LpΔclpP-pclpP LpΔclpP containing pclpP This study
JR32-pBC JR32 containing pBC(gfp)Pmip This study
LpΔclpP-pBC LpΔclpP containing pBC(gfp)Pmip This study
LpΔdotA JR32 with dotA deletion Lab collection
Plasmids   
pRE112 Mobilizable suicide vector for construction of gene knockouts in G- bacteria, oriT oriV sacB Cm [69]
pMD18-T cloning vector, Ap TaKaRa
pBC(gfp)Pmip ColE1 ori Cm Pmip gfpmut2 [70]
pREΔclpP pRE112::clpP for clpP deletion This study
pclpP pBC(gfp)Pmip containing clpP under the control of mip promoter This study
Primers   
PXC-F1 AGAGAGCTCCTGCCAGTAGGTCCTATAAG This study
PXC-R1 TATGACATACAAGTTGCTGGACATTCTAC This study
PXC-F2 CAACTTGTATGTCATAGGAACGCTCACC This study
PXC-R2 GATGGTACCTGGGAAAATTGACAAACCGT This study
PXH-clpPF TGGTGGAAGCTTTAGGAGTATCTAGCAAAGTTATAAGTC This study
PXH-clpPR TGGTGGTCTAGATGAGAAAAAAGGAGAGTAAGC This study
  1. *Abbreviations: Ap, ampicillin resistant; Cm, chloramphenicol resistant; sacB, sucrose sensitive.