Skip to main content

Advertisement

Table 1 Primers used in this study

From: The capsule of Porphyromonas gingivalis reduces the immune response of human gingival fibroblasts

Target Name Sequence (5'-3')
epsC epsC BamHI F ATATAGGATCC ATGAAAAAAGTGATGTTGGTC
  epsC EcoRI R CTATGAATTC ATCTTCGGCTAAATGCATCG
  epsC AscI F GAATATAGGCGCGCC ATGAAAAAAGTGATGTTGGTC
  epsC SpeI CTATACTAGT ATCTTCGGCTAAATGCATCG
eryF eryF ClaI F CCACCATCGAT CGATAGCTTCCGCTATTGC
  eryF ClaI R CCACCATCGAT GTTTCCGCTCCATCGCCAATTTGC
CP25 CP25 ClaI F GCCATATCGAT GCATGCGGATCCCATTATG
  CP25 AscI R CCTTTAGGCGCGCC CTTAATTTCTCCTC
IL-6 IL-6 F GGCACTGGCAGAAAACAACC
  IL-6 R GGCAAGTCTCCTCATTGAATCC
IL-8 IL-8 F GGCAGCCTTCCTGATTTCTG
  IL-8 R CTGACACATCTAAGTTCTTCTTTAGCACTCCTT
IL-1β IL-1β F AAGATTCAGGTTTACTCACGTC
  IL-1β R TGATGCTGCTTACATGTCTCG
hup-1 hup-1 F GAAAAGGCCAACCTCACAAA
  hup-1 F TCCGATGAGAGCGATTTTCT
glk glk F ATGAATCCGATCCGCCACCAC
  glk R GCCTCCCATCCCAAAGCACT
  1. In bold: restriction sites used in this study