Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: Identification and functional characterisation of Complement Regulator Acquiring Surface Protein-1 of serum resistant Borrelia garinii OspA serotype 4

Oligonucleotides Sequence (5'-3') Target
BBA68s ATGCGGCCGTGTTGTGTTTTAGTTTGGAT BBA68
BBA68as GTGGGATCCCATGCGCACCTTTTAGCAA BBA68
BGA66s ATGCGGCCGTGTTTTTAGTTTGGGCTCT BGA66
BGA66as GTGGGATCCCATGTGCCGTTAATAAAAATTG BGA66
BGA67s ATGCGGCCGATCAAGTGCAACGTATTTTT BGA67
BGA67as GTGGGATCCCATGTGCCGTTAATAAAAATTG BGA67
BGA68s ATGCGGCCGACATTATTGTTTTTAGTTTGGACTCT BGA68
BGA68as GTGGGATCCCATGTGCTGATAAAACC BGA68
BGA71s ATGCGGCCCATTGTTGTTTTTGGTTTAGACTC BGA71
BGA71as GTGGGATCCCATGTGTGCTGTTGATAAAATAG BGA71
qFlaBs GCTTCTGATGATGCTGCTG FlaB
qFlaBas TCGTCTGTAAGTTGCTCTATTTC FlaB
qFlaB Taqmanprobe GAATTRGCAGTAACGG-FAM FlaB
qBGA66s AGTTGTGCAGCAGCAATTTT BGA66
qBGA66as ATCCAGATCCTTTAAAGAC BGA66
qBGA71s TTCATATAGGTTGCTAATGCG BGA71
qBGA71as TTGCACACTCAAAACCAAAAA BGA71