Skip to main content

Table 2 Primers for RT-PCR and Quantitative Real Time RT-PCR

From: Genome-wide investigation and functional characterization of the β-ketoadipate pathway in the nitrogen-fixing and root-associated bacterium Pseudomonas stutzeriA1501

Primer No. Primer name Sequence (5'-3') Amplified fragmenta
1 RT1-5' AGCGAGAACCAATGGC 782 bp benRA intergenic region
2 RT1-3' TAGTCGATTCCCAGGG  
3 RT2-5' GCACTGGATCGAGGGAGC 456 bp benAB intergenic region
4 RT2-3' GTTGTGCGAGGTGCGTGT  
5 RT3-5' GCTTTCGCTACAAGACCG 503 bp benBC intergenic region
6 RT3-3' CGCACGTTGCTGATGGTC  
7 RT4-5' CGAACCCAAACACCTCAA 546 bp benCD intergenic region
8 RT4-3' CTCGGCCTCGATCTCATG  
9 RT5-5' TACCAGGAACATGAGAT 610 bp benDK intergenic region
10 RT5-3' ACGTCTACTTTTCGCATG  
11 RT6-5' GTTCTTCTGTTGCCTG 1074 bp benK and catB intergenic region
12 RT6-3' TCTTCGATGTCCTTAG  
13 RT7-5' CCTTCGTCACCCTCAACA 309 bp catBC intergenic region
14 RT7-3' CTTCACGCATCAGGCTCT  
15 RT8-5' GAAGATGATCGTGAAAC 1030 bp catCA intergenic region
16 RT8-3' TGAAGAAATGAATGTGC  
17 benA-5' CGGCTCGTCCACCTATGTCTAT 186 bp internal fragment
18 benA-3' AAACCACCGCCCTTCTTGC  
19 catB-5' CCTTCGTCACCCTCAACAG 159 bp internal fragment
20 catB-3' TCCAGGCTCAGGCCAAGAC  
21 pcaD-5' TTCGCCGAGCATTTCCG 173 bp internal fragment
22 pcaD-3' CCGATCAGTCCGCCCAT  
  1. aPCR reactions were carried out with the sets of primers indicated to the left.