Skip to main content

Advertisement

Table 3 Primers used in the present study

From: Rapid Leptospira identification by direct sequencing of the diagnostic PCR products in New Caledonia

Name Sequence References Target gene (amplicon size) Annealing temperature (°C)
lfb1-F CATTCATGTTTCGAATCATTTCAAA [15] lfb1 (331 bp) 60
lfb1-R GGCCCAAGTTCCTTCTAAAAG    
secY-F ATGCCGATCATTTTTGCTTC [18] secY (549 bp) 60
secY-R AGTTGAGCCCGCAGTTTTC    
SecYIVF GCGATTCAGTTTAATCCTGC [9] secY (202 bp) 54
SecYIV GAGTTAGAGCTCAAATCTAAG    
pfkB-F CCGAAGATAAGGGGCATACC [20] pfkB (559 bp) 52
pfkB-R CAAGCTAAAACCGTGAGTGATT    
pntA-F TGCCGATCCTACAACATTA   pntA (637 bp) 52
pntA-R AAGAAGCAAGATCCACAACTAC    
sucA-F AGAAGAGGCCGGTTATCATCAG   sucA (559 bp) 52
sucA-R CTTCCGGGTCGTCTCCATTTA    
tpiA-F AAGCCGTTTTCCTAGCACATTC   tpiA (554 bp) 52
tpiA-R AGGCGCCTACAAAAAGACCAGA    
mreA-F GTAAAAGCGGCCAACCTAACAC   mreA (601 bp) 45
mreA-R ACGATCCCAGACGCAAGTAA    
glmU-F GGAAGGGCACCCGTATGAA   glmU (556 bp) 50
glmU-R TCCCTGAGCGTTTTGATTT    
fadD-F AGTATGCGTATCTTCCTCCTT   fadD (576 bp) 50
fadD-R TTCCCACTGTAATTTCTCCTAA