Skip to main content

Table 5 Primer sets used for LAMP assays in the present study

From: Development of Loop-Mediated Isothermal Amplification (LAMP) Assays for Rapid Detection of Ehrlichia ruminantium

Target gene Primer type Sequence (5' to 3') Length Amplicon size with F3+B3
pCS20 F3 CTTGATGGAGGATTAAAAGCA 21 161
  B3 GTAATGTTTCATGTGAATTGATCC 24  
  FIP TGTGCCCATTCTTGTAAGATAGTTT-TTTCTATTCTGGAAAAATTCTGC 48  
  BIP TAAAGGATTTCCTGCACCAAGTT-ACTTCTACAGTAAAACAAGGATTG 47  
  LF TGCATCTTGTGGTGGTACTTTCA 23  
  LB AATAAACAAATCTGGCCCAGATCA 24  
sodB F3 GCCCCATATTTGAGTGCTAA 20 180
  B3 CGTAACAACACCATTCTTTGT 21  
  FIP ACAGAAATCAGTCCCTGCAACA-TGTTGAATTATCACTATGGAAAGC 46  
  BIP ACCTGCGGTTATTAAAGCTACACA-TATGATTCCATACTTGACCAGC 46  
  LF AAGCATTTACATAACCTTGATGAT 24  
  LB ATAGTGATTTAGCAACTAGATCAA 24