Skip to main content

Advertisement

Table 4 Primers used in this study

From: Impact of the Staphylococcus epidermidis LytSR two-component regulatory system on murein hydrolase activity, pyruvate utilization and global transcriptional profile

Primers Sequence(5'→3')* Restriction
Primers used for PCR products in allelic gene replacement
lyt- UF (upstream fragment) CCGGAATTC GAACCGATGGACCAGTAG BamHI
lyt- UR (upstream fragment) CGGAATTC TAAAGAGGGACGACAATGG EcoRI
lyt- DF (downstream fragment) CCCAAGCTT CAACAACTCGGTCTTCAA HindIII
lyt- DR (downstream fragment)) CTAGCTAGC AAAGGTATGGGAATGACG NheI
Primers used in complementation of 1457 ΔytSR1 strain
lyt- CF GGGGTACC TTATTGAAGACCGAGTTGTTGTTTA BamHI
lyt- CR CGGGATCC TATGAAACAAGCCAATGTAAGTGC KpnI
Primers used for real time RT-PCR in confirmation of microarray data
gyrB- RF TTTCACTTTCTTCAGGGTTCTTAC  
gyrB-RR CCATCTGTAGGACGCATTATTG  
lrgA- RF GCATTGTGAAATTAGGTCAAGTTG  
lrgA-RR ACTAATAATTGTGACGCAAAGCC  
serp2169- RF GCATCCGCTTCTCCAATATCTG  
serp2169-RR TAAACAACATACACACGCTAAACC  
ebsB- RF TTTGATGCTGCGACTAAAGG  
ebsB-RR CATTGCTGCCCATTCTGC  
arcA- RF GGCTGACTCATACATCTTGG  
arcA-RR GGGTTGTGGTGACATACG  
leuC- RF CCAGGATGTTCTATGTGCTTAGG  
leuC-RR CGCCTTTGCCTTGTCTTCC  
  1. * Primers were designed according to the genomic sequence of S. epidermidis RP62A (GenBank accession number CP000029).