Skip to main content

Advertisement

Table 4 Oligonucleotides used in PCR or for DNA sequence analysis

From: Prevalence of genetic differences in phosphorylcholine expression between nontypeable Haemophilus influenzae and Haemophilus haemolyticus

Gene Primer sequencesa Relative position in Rd Use
licA Fb: GTAGGATTTGTTAAAACTTGCTACAAGCC 1608693 probe
  R: GGCAATTCCTCTAACAGTTTAAATGCTGCG 1609579  
licA 5'F1: GAATAAATTCATAAGAYTCAGAGCCTTAC 1608523 lic1 locus
  5'F2: CAGCTAACCGAGCTTGGGTGAGAAAGTGG 1608476 and
  mid R: GGCGAAACTCATCGAATACGC 1609107 5'-CAAT-
  3'R: GCCCAAAATACAGCGGACAG 1609626 3'
licB F: ATGCGTGGCTATCTCTTTGGCATAC 1609583 probe
  R: TCATTTTTGTTCCCCTTTGTAATAAAGTG 1610461  
licB 5'F: GTTATTTGATATAGCGACGATCATTGAGG 1609316 lic1 locus
  mid F: CGGATTCGCCTTGGCTATTATTTCTTCTTCG 1609957  
  mid R: GAGGATATCACTATTTCAGATGACCACCC 1610091  
  3'R: GTGTAAATACCCTGTAACAATGACAATATTATCG 1610628  
licC F: ATGAATGCAATCATTTTAGCAGCAGG 1610458 probe
  R: ATGTGGTGATAGTCATCAAGGTTATCC 1611125  
licC mid F: CGTATTGATATTGGTTCACTGAATCAACCC 1610884 lic1 locus
licD F: ATGAAAAAATTGACTCTCAGAG 1611159 probe
  R: TTACAAAATATACGCTTCTTGAATATG 1611956  
licD 5'F: AATTGGGATACCATTCCGATGG 1611016 lic1 locus
  3'R: AAGGGGCGCAAGAGCAGTTAG 1612129 and licD alleles
  1. a All oligonucleotides based on DNA sequences from H. influenzae strain Rd or from H. haemolyticus lic1 sequence in this paper to make dot-blot hybridization probes or sequence the lic1 locus, the licD gene alleles, or the licA gene tetranucleotide repeats
  2. b Forward primer begin downstream of licA gene tetranucleotide repeats