Skip to main content

Advertisement

Table 2 Primers used in this study

From: Genes regulated by the Escherichia coli SOS repressor LexA exhibit heterogenous expression

Primers nucleotide sequence 5'-3'
ColA-F TCCTCGAGATGCTCTGATCAGTTCACT
ColA-R TCGGATCCTACCACCACCCGGCTC
ColN-F TCCTCGAGGATCAGTTCACTGGTTTCA
ColN-R TCGGATCCGCCACTGGTATTACCAATG
ColE1-F TCCTCGAGCAGTTCACTGGTTTCAACC
ColE1-R TCGGATCCCCCGTCAGGAGTACCATTC
ColE7-F TCCTCGAGAGGAATACAACACCTTAAA
ColE7-R TCGGATCCTAGGGCCGCCATTAATGTT
ColM-F TCCTCGAGGAGTTCTCAATATATATTTCCAGT
ColM-R TCGGATCCCAGGAACATGCGGTGCTGAA