Skip to main content

Table 2 Oligonucleotides used in the present study

From: A rapid and simple method for constructing stable mutants of Acinetobacter baumannii

Oligonucleotide name Sequence (5' to 3') Application
33intUP CTGGTGACGTTGCTGGTACA Construction of the omp33::TOPO mutant
33intDW CGTTACCGATGATACCGAAG Construction of the omp33::TOPO mutant
33extUP CCTTAACATTACGTTTCATC Confirmation of the omp33::TOPO mutant
33extDW CATGTAAGATGCACCAACTGC Confirmation of the omp33::TOPO mutant
Kmup CCGGAATTGCCAGCTGGG Kanamycin amplification
Kmdw TTCAGAAGAACTCGTCAAG Kanamycin amplification
33upFW GCTGAGCTCGTAAAGTCTGATG Construction and confirmation of the Δomp33::Km mutant
33upintRV CCCAGCTGGCAATTCCGGGGCTAATAATACAGCAGTGG Construction of the Δomp33::Km mutant
33dwintFW CTTGACGAGTTCTTCTGAAGGCTTAAATGCTAAATTCCG Construction of the Δomp33::Km mutant
33dwRV CGTTGCCTTTTACCGTAGTC Construction and confirmation of the Δomp33::Km mutant
33FWnest GCAATTGAATTGTGTGAC Construction of the Δomp33::Km mutant
33RVnest TGATAGCAATTCAAGAGG Construction of the Δomp33::Km mutant
OxyupFW AGTTAAAAAAAATTGAAGAAA Construction and confirmation of the ΔoxyR::Km mutant
OxyupintRV CCCAGCTGGCAATTCCGGTCACTTGATGATCTCGATTTA Construction of the ΔoxyR::Km mutant
OxydwintFW CTTGACGAGTTCTTCTGAATGAAGATCACCAGTTAATGG Construction of the ΔoxyR::Km mutant
OxydwRV TATATTAACCATATTGAAGCC Construction and confirmation of the ΔoxyR::Km mutant
OxyFWnest GCAACTTGATGCAGCGGT Construction of the ΔoxyR::Km mutant
OxyRVnest TCAACGTAGCTACTATCC Construction of the ΔoxyR::Km mutant
SoxupFW ATGAAAGAAAAAAACTATATA Construction and confirmation of the ΔsoxS::Km mutant
SoxupintRV CCCAGCTGGCAATTCCGGATATTTACTTAGGGCTTGTTT Construction of the ΔsoxS::Km mutant
SoxdwintFW CTTGACGAGTTCTTCTGAAGAACAATGTCCATT AGAAA Construction of the ΔsoxS::Km mutant
SoxdwRV TCTGACTTCGTTTTTTGCTTA Construction and confirmation of the ΔsoxS::Km mutant
SoxFWnest AATTGCACGTTGCGATAG Construction of the ΔsoxS::Km mutant
SoxRVnest TAAACCAGATAGCCCAAC Construction of the ΔsoxS::Km mutant
ATG33XbaI* ATCGTCTAGACCCAGCTTTATCTCTTGTTA Cloning of the omp33 gene
STOP33NcoI* ATCGCCATGGGGACTGGACTCAGGAAGATTTG Cloning of the omp33 gene
SoxRTup AGGAACTGTAATTGCACG RT-PCR for soxR detection
SoxRTrv CCAATCGAGAGATAGCTC RT-PCR for soxR detection
OxyRTup ATGGCTGCATTACCCTCACT RT-PCR for oxyR detection
OxyRTrv GCGCTCTACAATCTTCTCAC RT-PCR for oxyR detection
GyrBup ATGAGTTCAGAGTCTCAATCA RT-PCR for gyrB detection
GyrBrv CTGTTAAACCTTCACGCGCAT RT-PCR for gyrB detection
T7 AATACGACTCACTATAGGG Universal primer of the pCR-BluntII-TOPO plasmid
SP6 ATTTAGGTGACACTATAG Universal primer of the pCR-BluntII-TOPO plasmid
pETRAFW TTCTTCGTGAAATAGTGATGATTTTT Primer of the pET-RA plasmid
pETRARV CTGTTTCATATGATCTGGGTATC Primer of the pET-RA plasmid
  1. *Oligonucleotides including the indicated restriction site (underlined)