Skip to main content

Table 1 Oligonucleotides used in this study

From: Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi

Numbera Name Target/Purpose Sequence (5' to 3')b
1 Bsamut-fwd Introduction of silent mutation in OspA L10 codon yielding Bsa I site GGGAATAGGTCT C ATATTAGCCTTAATAGC
2 Bsamut-rev Introduction of silent mutation in OspA L10 codon yielding Bsa I site TGCTATTAAGGCTAATATG AGACC TATTCC
3 Bstmut-fwd Introduction of silent mutation in mRFP1 V15R16 codons yielding Bst BI site TGCGCTTCAAGGT T CG A A TGGAGGGCTCCG
4 Bstmut-rev Introduction of silent mutation in mRFP1 V15R16 codons yielding Bst BI site GGAGCCCTCCAT T CG A A CCTTGAAGCGCATGAAC
5 Rmut-oligo Random mutagenesis oligo TATTTATTGGGAATAGGTCTC ATATTAGCCTTAATAGCATGTAAGCAAAATGCCTCCTCCNNKNNK GTCATCAAGGAGTTCATGCGCTTCAAGGTTCGAA TGGAGGGCTCCGTG
6 Rmut-rev Generation of double-stranded DNA from Rmut-oligo CACGGAGCCCTCCATTCGAA CC
7 Mutscreen-fwd Amplification of mutated ospA:mrfp1 region from PflaB ATGCTATTGCTATTTGCGTTTC
8 Mutscreen-rev Amplification of mutated ospA:mrfp1 region from ospA ATGGTCTTCTTCTGCATTAC
9 Mutscreen-seq Sequencing of amplified ospA:mrfp1 region from PflaB AAAGGATTTGCCAAAGTCAG
  1. aNumbers correspond to primer numbers indicated in Figure 1.
  2. bIntroduced restriction sites are underlined; mutated nucleotides are in bold.