Skip to main content

Table 2 Primers used in this study

From: The small regulatory RNA molecule MicA is involved in Salmonella enterica serovar Typhimurium biofilm formation

Primer Sequence Purposea
PRO-483 TTTCAGAATCGAAAGGTTCAAAGTACAAATAAGCATATAAGGAAAAGAGAGTGTAGGCTGGAGCTGCTTC FW CMPG5628
PRO-484 AGCGGGGGCGATTATCCGACGCCCCCGACATGGATAAACAGCGCGTGAACCATATGAATATCCTCCTT RV CMPG5628
PRO-487 TTTGCTGGCTTTATGCGCGACCACCTCAACGGTAACGGCGTTGAGATTATGTGTAGGCTGGAGCTGCTTC FW CMPG5630
PRO-229 CGGCCATAAACCGGGGTTAATTTAAATACTGGAACCGCTTACAAATAAGACATATGAATATCCTCCTTA RV CMPG5630
PRO-0472 TGATGTTTCCGAGGGGCTTGCGCCCCTCGTTACGTCAGATGACCATCGTACATATGAATATCCTCCTTA FW CMPG5648
PRO-0473 CCATTCGCAGTTTTAGAAGGTGGCAGCGTTTAAAGAAAAGCAATGATCTCGTGTAGGCTGGAGCTGCTTC RV CMPG5648
PRO-0101 ATTCTAGACTTTACATCGCCAGGGGTGCTCAG FW pCMPG5685
PRO-0102 ATCTGCAGCGCTGAAAGGCGTTGTCATCCAG RV pCMPG5685
PRO-0474 ATTCTAGACCATTCGCAGTTTTAGAAGG FW pCMPG5687
PRO-0475 ATCTGCAGTCATCAGACCTGATGTTTCC RV pCMPG5687
PRO-2993 CTCACGGAGTGGCCAAAATT FW RT-qPCR MicA
PRO-2994 GACGCGCATTTGTTATCATCAT RV RT-qPCR MicA
PRO-1150 AAACGCGGGCAACTTCAG FW RT-qPCR rfaH
PRO-1151 GTCAGGCAACTTACCGCTTGT RV RT-qPCR rfaH
  1. a FW: Forward primer; RV: Reverse primer