Skip to main content

Table 1 Oligonucleotides used in this work.

From: A bacteria-specific 2[4Fe-4S] ferredoxin is essential in Pseudomonas aeruginosa

name Sequence (5' - 3') comments
FDX-Eco GAATTC GACCATGTGATCATCGCG Construction of lacZ reporter
FDX-Bam GGATCC TCAATCGTCAGTGATTTTCAGGG Construction of lacZ reporter
FDX-Eco200 GAATTCgccgctctcggcggg Construction of lacZ reporter
FDX-F1 GGGAAGGCGAATGTCTTCCTC Deletion of fdx1
FDX-R1 GGATCAGGCCTTGCCCTC GAG GGACATCTAACAACTCC Deletion of fdx1
FDX-F2 CTCGAG GGCAAGGCCTGATCCCC Deletion of fdx1
FDX-R2 GGGAGTCCCGAGCCGTAAGG Deletion of fdx1
FDX-F3 CCCGGG TTGTTAGTA GTCCCTGAAAATC Insertion mutagenesis of fdx1 (inverted nucleotides in bold)
FDX-R4 CCCGGG CACTGCGGCTCGTCGTAG Insertion mutagenesis of fdx1
FDX-F0 CTGGCGCACTTCGTCAAGGAG Amplification of the genomic copy of fdx1
FDX-R0 GCAGAAGGAAGAATCCACCGC Amplification of the genomic copy of fdx1
FDX-PstI CCCTGCAG GTCGCGGTTGGAGTTGTTAG Construction of pJN-Fdx1
FDX-XbaI GGTCTAGA AGGACAGGCGCCGGCGG Construction of pJN-Fdx1
F2PaFd CGCAAGGCGAAGAAATCTAT Primer for fdx1 RT-PCR
R2PaFd TCCTTGCTCTCGACATTGG Primer for fdx1 RT-PCR
R1bacRNA AGAGTTTGATCCTGGCTCAG Primer for rRNA RT-PCR
R2bacRNA ACTGCTGCCTCCCGTAGGAG Primer for rRNA RT-PCR
  1. Recognition sequences for restriction enzymes are underlined