Skip to main content

Table 3 Primer and probe sets for each serotype used in quantitative PCR

From: Universal and specific quantitative detection of botulinum neurotoxin genes

Toxin Class Sequence Location on Toxin Gene(bp)
BoNT A Forward TGGTTTTGAGGAGTCACTTGAA 582
BoNT A Reverse TCATGTCCCCCAAATGTTCT 809
BoNT A Probe TGCAGGCAAATTTGCTACAGATCCA 627
BoNT B Forward CAAGAAAACAAAGGCGCAAG 619
BoNT B Reverse CTGGGATCTTGYCCTCCAAA 833
BoNT B Probe CGTGGATATTTTTCAGATCCAGCCTTG 652
BoNT C Forward CAACTTTAATTATTCAGATCCTGTTGA 18
BoNT C Reverse GGCTTGTAACTCGAGGAGGTT 199
BoNT C Probe TGAGCCTGAAAAAGCCTTTCGCA 93
BoNT D Forward CCATCATTTGAAGGGTTTGG 541
BoNT D Reverse TGGGTCCATCTTGAGARAAA 791
BoNT D Probe GATTCGTCCACAAGTTAGCGAGGGA 744
BoNT E Forward ATAATGGGAGCAGAGCCTGA 448
BoNT E Reverse CCCTTTAGCCCCATATAGTCC 678
BoNT E Probe TGCCAAGCAATCACGGTTTTGG 515
BoNT F Forward GTSAGACAATACCTCAAATATCAAATCG 1488
BoNT F Reverse CTGGYACTTTTTGTGCATGT 1646
BoNT F Probe TGCCAAGATATGATTCTAATGGAA 1551
BoNT G Forward ATCCAACCTGGAGCTGAAGA 427
BoNT G Reverse GCTGGATCTGCAAAATACGC 674
BoNT G Probe TGGCCATTCCCCAATATCAGAAGG 534
  1. Y= C or T
  2. R= A or G
  3. S= G or C
  4. Indicated in this table are the type specific primers and probes for each BoNT tested in this manuscript. Included are forward, reverse and probe sequences and their locations within the toxin gene. Bases indicated in bold represent degenerate bases: Y represents C or T; S represents C or G, and R represents A or G.