Skip to main content

Table 2 Oligonucleotide primers used in this study.

From: The tricarboxylic acid cycle in Shewanella oneidensis is independent of Fur and RyhB control

Primer name Sequence
strain construction  
fur-F1 GGTCGACCAAGAGATTAGCAATGACAGATG
fur-R1 GGAATTCGAGCAAGCTTATTCGTCGT
ryhB-F1 GGTCGACAGGAGGAACTCTGATGACTGGTAATCTG
ryhB-R1 GGAATTCAGTTAAATGTGGCGCAAAC
Reverse Transcription-PCR
ryhB-F2 TCTGACGTTGTTAAAGTGCTCC
ryhB-R2 CCTAATGCGCCTATTCGCT
Control 1-F TCAGGTTGTTTGGTATTGTGC
Control 1-R CCATCAATCAAGGTTGTCG
Control 2-F CTGTCAAATGGTGTGCTGC
Control 2-R GTGTAACAGTGCTAAAGCCTGC
Control 3-F TCTACTCAAATGACGAGCTGC
Control 3-R GAAAAGCCGCCAAATGC
Control 4-F TATGGTTTCCCGCTTTCG
Control 4-R AACGCATCAGTGCTATTTGC
Control 5-F TCACTCACAGAACGCTTCG
Control 5-R GCAGCTACAGAATGTCACTACG
Control 6-F TCTAGCAGGGATTAAATGAGC
Control 6-R CCTTCGCCTTGTCTAAAGC
5'- and 3'-RACE assays  
5'- RNA adapter GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA
ryhB-R3 AGAGTGTGTGAGCAATGTCG
3'- RNA adapter UUCACU GUUCUUAGCGGCCGCAUGCUC-idT
Quantitative RT-PCR  
RyhB-F TCTGACGTTGTTAAAGTGCTCC
RyhB-R CCTAATGCGCCTATTCGCT
SdhA-F GAGCAGTTAAAAGCCATCC
SdhA-R GTTGTCCAATTCTAAACACTCG
AcnA-F ACCAACAAACGCTAGACTACC
AcnA-R ATCATCGCTCCACAAACC
SodB-F TCTACTGGAACTGCTTAGCACC
SodB-R TGAATGCATCGAATGAACC
RecA-F AACCCAGAAACCACAACG
RecA-R ACCAACCACCTCATCACC
  1. Primer sequences were derived from the S. oneidensis MR-1 genome sequence [25]. F and R stand for forward and reverse primers, respectively.