Skip to main content

Table 1 Primers for amplification and sequence analyses of genes encoding the four shifted proteins found in rifampicin resistant meningococci

From: Neisseria meningitidis rifampicin resistant strains: analysis of protein differentially expressed

Primer Sequence (5'→3') Protein encoded (Locus tag)
ADZ-f 576170GCGTTTCAGACGGCATTTGT576189* putative zinc-binding alcohol dehydrogenase (NMC0547)
ICD-f 893762ACGACGAATGTTCAGACGG893780* isocitrate dehydrogenase (NMC0897)
PTA-f 607259AAGCCGTTTGTCAGCCTT 607276* putative phosphate acyltransferase Pta (NMC0575)
POX-f 445746AAAGCCGGATAAGTGGGAAC445765* putative oxidoreductase (NMC0426)
  1. * the position referring to the corresponding accession number of N. meningitidis strain FAM18, accession number AM421808.