Skip to main content

Table 3 Primers for real time RT-PCR to measure gene expression using RNA from alveolar macrophage (MH-S) cells

From: Extracellular Paracoccidioides brasiliensis phospholipase B involvement in alveolar macrophage interaction

Cluster IDa Geneb Forward primer (5'-3') Reverse primer (5'-3')
272294 Rps9 CGCCAGAAGCTGGGTTTGT CGAGACGCGACTTCTCGAA
21961 nkrf ACCTTTCAACCTACGATGGTCAGA GAGCTCTCACATGGAATTTGGAA
575033 nfkb AGCCAGCTTCCGTGTTTGTT AGGGTTTCGGTTCACTAGTTTCC
104798 tnf -α GTACCTTGTCTACTCCCAGGTTCTCT GTGGGTGAGGAGCACGTAGTC
574821 clec 2 CTCTTCTTGGTGGCGTGTGA AACAACCAGCCCCATGGA
3989461 il-1β GTGTGTGACGTTCCCATTAGACA CAGCACGAGGCTTTTTTGTTG
1346060 trl2 AAGAGGAAGCCCAAGAAAGC CGATGGAATCGATGATGTTG
5120996 cd14 CGCAGCCTGGAATACCTTCTA CCGCTTTAAGGACAGAGACTTGATA
  1. a ID: identification.
  2. b Abbreviations: Rps 9 (constitutive ribosomal macrophage gene); nkrf (NFKappaB repressing factor); nfkb (P50 subunit of NFKappaB); tnf-α (tumor necrosis factor-alpha); clec 2 (C- type lectin like receptor); il-1β (Interleukin-1β); trl2 (toll-like receptor 2); cd14 (glycosyl-phosphatidylinositol-anchored glycoprotein).