Skip to main content

Table 2 Primers Paracoccidioides brasiliensis used for real time RT-PCR

From: Extracellular Paracoccidioides brasiliensis phospholipase B involvement in alveolar macrophage interaction

Cluster IDa Geneb Forward primer (5'-3') Reverse primer (5'-3')
50 sod3 CTGTTCGCTGGGCTTTGC TCAGTAGTGACGGCTTCCATCAT
1688 icl1 GCTCACCCAGATGGTCAAAT AGTATCCGCATCCGCAATAA
3306 plb1 GCAATGCAAGGGAAGAAAGA CGATCCGAGGAACTCTAACG
  1. a ID: identification.
  2. b Abbreviations: sod3 (Cu, Zn superoxide dismutase); icl1 (isocitrate lyase); plb1 (phospholipase B).