Skip to main content

Table 1 VNTRs characteristics and primers for PCR amplification [21]

From: Longitudinal survey of Staphylococcus aureus in cystic fibrosis patients using a multiple-locus variable-number of tandem-repeats analysis method

VNTRa repeat size (bp) Mu50 N° repeats   oligos Locus name
Sa0122b 24 10 L AGCAGTAGTGCCGTTTGCTT spa
    R AAGACGATCCTTCAGTGAGCA  
Sa0266c 81 6 L TTGGATATGAAGCGAGACCA coa
    R CTTCCGATTGTTCGATGCTT  
Sa0311 55 3 L AGGGTTAGAGCCCGAGACAT STAR
    R CACGGGATTGGAACAGAAAT  
Sa0704 67 4 L CGCGCGTGAATCTCTTTTAT intergenic
    R AGTCCCATATCGTGCGTTAAA  
Sa0906F 56 3 L CATGTATTCATGGGATTGCAGC STARd
    R CAGATTTTC CTTCAACAATTATCAC  
Sa1132 63 6 L CGTGCATAATGGCTTACGAA SAV1078
    R AAGCAGCAGAAAAAGCTAAAGAA  
Sa1194 67 7 L AGTGCAAGCGGAAATTGAAG intergenic
    R ATCGTGAAAAAGCCCAAAAA  
Sa1213F 56 5 L GGCTGATGCTAAAGTTGCATTAGA STAR
    R GTGGCATGTTCTACAAACGTAAAC  
Sa1291 64 4 L GGGGGAAATTCTAAGCAACC intergenic
    R CGAAATTTTCCACGTCGATT  
Sa1425 58 4 L TCGTTATTAAACTACGAATTCTCGATT STAR
    R ATTTCGRGAATGATTCAATTCAATTTT  
Sa1729b 56 5 L TACTTAAAAATARGAATACATAATTAG STAR
    R CAACAATAAATTACTTATTTGAAGTT  
Sa1866 159 3 L CTGTTTTGCAGCGTTTGCTA SAV1738
    R GCAACTTGAAGAAACGGTTG  
Sa2039 56 3 L TTCGTTCTACCCCAACTTGC STAR
    R GAGCCTGGGTCATAAATTCAA  
Sa1756e 131 1 L AATTATAGCATATTAGAGCCCCTTA 50S ribosomal protein L27
Alias SIRU15    R ACGTAAAGGTCGCGACAAAA  
  1. a The chromosomal position on the Mu50 genome, in kilobase-pairs is indicated in the VNTR name, for example Sa0120 is at position 120,000.
  2. b primers different from [39]
  3. c primers different from [40]
  4. d STAR stands for S. aureus repeat
  5. e primers different from SIRU15 [41]