Skip to main content

Table 7 Oligonucleotide primers used in this study

From: Identification of the full set of Listeria monocytogenes penicillin-binding proteins and characterization of PBPD2 (Lmo2812)

primer Sequence 5'→3'
pET6up3a AGCAAATCATATG GCGGTTTATTCAGTCG
pET6downa ATGCTCGAG ATCTTCTTTAAACCCAACCTC
La2812 ATCCGCTATCTGAATCGCCT
Pb2812b TTCAGCTGTTCCAA TTATTGCTCCGTAGAACAGGCTG
Lc2812 TTGGAACAGCTGAACGTGGA
Pd2812 CTAGAGTCAATCCGCAGCCA
La2754 CCGTTATTGACATCTGCTAC
Pb2754b CCGCAGAAGCACCAA TAACTGCCAGCGACGTTGAA
Lc2754 TTGGTGCTTCTGCGGCTTGT
Pd2754 TAGCAGATGGCATCATCCGG
  1. aNucleotide substitutions to create restriction sites are underlined
  2. bOverhangs complementary to SOE primers are underlined