Skip to main content

Table 2 Sequences of primers used in co-transcription RT-PCR assays, cloning experiments and EMSA assays.

From: Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans

Primers used in RT-PCR assays
cbb1 operon
Numbera Gene Forward primer (5'-3') Numbera Gene Reverse primer (5'-3')
1 cbbR CAACGCCGTGTTGCTCGAA 2 cbbL1 CTAGACTTTTTTACGGCCATGCTT
3 cbbL1 CTGCCAATCGTGTCGCGC 4 csoS2 CGCACGGGAAAGCGACTT
5 csoS2 CCTATGGTGCCGTGCCAAC 6 csoS3 GTGCATGACGCACGCCC
7 csoS3 GTCAGCGGGTCAAAGCCG 8 csoS1A GCCGCCTTGGTCATCG
9 csoS1B GGAGCAGATGCGTGTGAGCG 11 parA AGTAGAACCCCGCCGAGCCAA
10 bfrA CGCGCAGAAGAGTTACAAGCCTTG 12 parA CTGATCGAACCCTGAGGATCGG
13 parA GTGCTGCGGTTGAAGGGGT 14 hyp2 GTGGAGTTCGATAATGGCGGAG
15 hyp2 CGAGAAGCCTCCGCCATTATC 16 cbbQ1 GCCTGTGGGTCCTTTCAGCAT
18 cbbO1 TGACGCCAGGAAAGCGGTG 17 cbbO1 CAGGGATTTCAGGCTGGTCG
19 cbbO1 GCAGAGGCTGCCAGAAAAGCT 20 cbbA AAGCACCTACCGCGTATCCGT
    21 bioD a CAGTGCCACCGCCACCC
cbb2 operon
  Forward primer (5'-3')'   Reverse primer (5'-3')  
1 tatC a ACGACGGCGTCTAGAACCGCC 2 cbbL2 CCGGTAATCCTCTAGACCCGCGTT
3 cbbL2 CATCGAGAAGGAAGGCAAGGC 4 cbbS2 CGCAACCTGTTGACGGATCTG
5 cbbS2 ACCGGAAAACGCCTTCGGC 6 cbbQ2 GGTCAATGGGCCATCCTGCC
7 cbbQ2 AGGGTGTTGAGGCGAAGGCC 8 cbbO2 GTACGATGGGCGTGTGCGC
9 cbbO2 GCCTACAGCGAGGAGGCCATG 10 yfeA a GCGGAGCCTTGTCCCTCGG
cbb3 operon
   Forward primer (5'-3')'    Reverse primer (5'-3')
1 hyp4 a TACGAAGGCGGCTCCCCG 2 hyp3 CGACGGCAATCGGAGTCTTT
3 hyp3 CGGGTGATCGCGCTGGAT 4 cbbT CAGAATGCCGTCGTGACCA
5 cbbT ATCGGCATCGACCACTTT 6 cbbK TCCATCATACGCAGGACA
7 cbbK CCTACATCAGTACGGGTG 9 cbbA CACCTGCTCCAGGTTGTT
8 pykA TTGATCCTCATCACCATCGG 11 cbbE GATATGGATATAGTCGGCACCC
10 cbbA GCAGGCCAGCAAGATCAA 14 trpE GCCGACAAGGGAGTATCGA
12 cbbE CTATCGAACTGGAAGTGGATGG 16 trpG CGATAGCCGCCACGTCG
13 cbbZ TCGGCGATTCACGTAACG 17 trpC a AGGGCCACTGCCGCCTGC
15 trpE GAAACCATGAACAAACGCCG    
cbb4 operon
   Forward primer (5'-3')'    Reverse primer (5'-3')
1 ompA a GGTATTTCCTATTTTTGGGGTGGC 3 sahA CGGCAATGCGGACTTCCTTAC
2 metK TTGGGAGCGGACCGACAAG 5 metF AAGCATACTCGGGACCCAAGG
4 sahA CTTCGCGGGGGTGCTGA 7 cbbP GACGGGATGTTTTTTGGACATGG
6 metF CACCGAGCCTGCATTTTTACACC 9 ynbD GGCTACAGCCACCACGGGAT
8 cbbP ATGTTGCCGGGCAGTTTTATGTC 10 fbnA a GCGAGGTGGACTGGACGGA
Primers used in EMSA assays and cloning experiments
Letter designation Forward primer (5'-3')   Reverse primer (5'-3')
(a) Pcbb1 CGGCAGCGAAGATCTTGAGTTGGTGC (b) Pcbb1 CTCCGGCCTCATACTTTTTTACGG
(c) cbbRfw TCTATCCGTCATGCAACCTTG (d) cbbRrev GCGCCATTCCTTTTCACCATG
(e) Pcbb2 ACGACGGCGGCAAGCACCGCC (f) Pcbb2 CCGGTAATCCTTCACACCCGCGTT
(g) Pcbb3 CATTGAACAGGGTCAGCTCCTGG (h) Pcbb3 ATCGGAGTCTTTGATCATGCGCC
(i) Pcbb4 TTTGGGGTGGCAGCAAGAAGT (j) Pcbb4 GGAAACGGATTCAGAGGTGAAAAG
  1. aGenes lie outside the operons and are not shown in Figure 2.
\