Skip to main content

Table 3 Primers used in this study

From: The type IV pilin, PilA, is required for full virulence of Francisella tularensis subspecies tularensis

Primer Primer sequence 5'-3' RE site
pilA LFF GAGCTCACGCGT-CTTACTTGCCGGATCATTACCAAC SphI
pilA LFR CTGCAG-CCTTCTTTATAGTTTAGTTTAC PstI
pilA RFF CTGCAGGTAGATAAACTAAGCCACTTTCATGTG PstI
pilA RFR GGATCCGCATGCTCAAGGCTTCTGTCAATCTTGTTC MluI
CAM PstIF GCCTGCAGGTAAGAGGTTCCAACTTTCAC PstI
CAM PstIR TGATCTGCAGTTACGCCCCGCCCTGCCACTCATC PstI
PilC-A GCATGTCCTAGGGTCAAGCTTAGATATTGCTGAA AvrII
PilC-B TATATCGCATCGCCAAATAGCATATTTTTTATTCC  
PilC-C GCTATTTGGCGATGCGATATAATATACTTTTAAAAA  
PilC-D GCATGTGTCGACGTCCTGAGAAAATATCTAGACA SalI
PilT-A CATTATGTCGACTATGCAACAGTTCTTGATGGT SalI
PilT-B TACTACAATGTATAGTAATTTTCTTATCATATCAAG  
PilT-C AGAAAATTACTATACATTGTAGTAAGGTAATCA  
PilT-D CATTATTCTAGACAGGATTAACGGCAGCTAAAA XbaI
PilQ-A3 GCATGTCCTAGG TCAGTCAATGGAAGCACAGAT AvrII
PilQ-B3 TATCTGCTATCATGTTAGAACAACTAATAACTTCTT  
PilQ-C3 TTGT TCTAACATGATAGCAGATAATAGTTGCAAA  
PilQ-D3 GCATGTGTCGACAGAAAGTAATGTTGTTGGTATTT SalI
RT-PCR
primers
  
PilA_A GATCCCGATGTACTCTAACTA  
PilA_B CCATTAGCTCAACTAGTGAGAA  
PilA_C ATCTTAGCAGCTGTAGCAATA  
PilA_D GGGGTAGTACTTTAAATCCT  
PilA_E CTTACTGAGTTACTTGTTGTTAT  
PilA_F GTCTTTCTGATCTATATGCTTC  
PilC_A GTCAAGCTTAGATATTGCTGAA  
PilC_B GTCTCTGGAGCACTGTTTGTAT  
PilC_C AAGGTAGTATTGATGCTGACAC  
PilC_D CCGTTGCTAAAGACACCATA  
PilC_E GATGCGATATAATATACTTTTAAAAA  
PilC_F CGAATTGGTATTGGCCAGAT  
PilQ_A TATGGTCAGGTAGAAGATGTAA  
PilQ_B CATCAATTTACCTTACTAATGTAT  
PilQ_C GCCTGAGCAGTAGTATAGTTT  
PilQ_D AGTTGGTGCTGGAAAATCTAC  
PilQ_E CAGGATAGTTTCTTCTACTAAA  
PilT_A CTATTAGGCGTGAAAGCAGTT  
PilT_B TAGTAATTTTCTTATCATATCAAG  
PilT_C ATGATGCGAGATTTAGGGTA  
PilT_D CAGCAGGTGGAAATACAGAT  
PilT_E TACATTGTAGTAAGGTAATCA  
PilT_F GGTAGAGTTGAATCAGCGTTTA