Skip to main content

Table 1 Plasmids, bacterial strains and primers used in this study

From: Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

  Description, characteristicsa or sequence (5'→3') forward primer, reverse primer Source or reference
Plasmid   
pAS222 Shuttle vector, TetR [25]
pGhostΔmpD Insertion inactivation vector of mptD This work
Strain   
E. coli EPI300   Epicentre Technologies, USA
E. faecalis V583 Wild type [20]
MOP1 Resistant mutant, from exposure to pediocin PA-1 10 BU/ml This work
MOP2 Resistant mutant, from exposure to 10 mM 2-deoxsyglucose This work
MOP5 Resistant mutant, from exposure to pediocin PA-1 640 BU/ml This work
MOM1 Inserted inactivated mptD This work
Pediococcus acidilactici Pac 1.0 Pedioicn PA-1 producer [21]
Primer   Target DNA
arcA-F TAACTCGACAACGGGAAACC EF0104, arcA
arcA-R TCCCAATGGCCACTACTTCT EF0104, arcA
citE-F CGGTGATTAACCCTCGTCAA EF3320, citE
citE-R ACGGAGATAACACCGGAACC EF3320, citE
dnaB-F TAGAAATGGGGGCAGAATCA EF0013, dnaB
dnaB-R ATTCGCACGGGACAAACTAC EF0013, dnaB
mptAB-F TGACCTATGGGGAGGAACAC EF0020, mptAB
mptAB-R GTCGCAATTTCTTGTGCTGA EF0020, mptAB
mptC-F ATTCGTATTGCGATTCCAGCA EF0021, mptC
mptC-R TGCATAACCTACGGCAACGAC EF0021, mptC
mptD-F TCGTTGGTCATTCATGTGGT EF0022, mptD
mptD-R GTTGAACTAATGCGGCCAGT EF0022, mptD
mptDi-F GAAGGAGGAGCAAAGAAAATGGCA EF0022, mptD
mptDi-R CACCGACACCGGCTAAAGGAC EF0022, mptD
mptO-F TATCCAAATTCCGTGGGAAG EF0024, manO
mptO-R TAACACTCGCTTCGGCTCTT EF0024, manO
pgk-F AATGACGCTCCTTTCCACAC EF1963, pgk
pgk-R TTTCAAATACGCCCATTGGT EF1963, pgk
  1. aTetR, tetracycline resistance