Skip to main content

Table 1 The PCR primers used in the study

From: Matrix metalloproteinase-3 promoter polymorphisms but not dupA-H. pylori correlate to duodenal ulcers in H. pylori-infected females

SNP/gene Primer sequence (5' →3') Size (bp) Restriction enzyme Reference
MMP-3 -1612 5A/6A GATTACAGACATGGGTCACG 120 Xmn I Shibata et al, 2005
  TTTCAATCAGGACAAGACGAAGTTT   6A: 120 bp  
    5A: 97 bp + 23 bp  
MMP-7 -181 A/G TGGTACCATAATGTCCTGAAT 150 EcoR I Jormsjö et al, 2001
  TCGTTATTGGCAGGAAGCACACAATGAATT   A: 150 bp  
    G: 120 bp + 30 bp  
MMP-9 exon6 A/G CCATCCATGGGTCAAAGAAC 295 Sma I Shibata et al, 2005 *
  GGGCTGAACCTGGTAGACAG   A: 295 bp  
    G: 192 bp + 103 bp  
TIMP-1 372 C/T GCACATCACTACCTGCAGTC 175 BssSI Wollmer et al, 2002
  GAAACAAGCCCACGATTTAG   T: 175 bp  
    C: 152 bp + 23 bp  
TIMP-2 -418 G/C CGTCTCTTGTTGGCTGGTCA 304 BsoBI Zhou et al, 2004
  CCTTCAGCTCGACTCTGGAG   C: 253 bp + 51 bp  
    G: 230 bp + 51 bp + 23 bp  
jhp0917 _1 TGGTTTCTACTGACAGAGCGC 307 - Lu et al., 2005
jhp0917 _2 AACACGCTGACAGGACAATCTCCC    
jhp0917 _3 GCCTAAGACCTCAAACTAGC 296 - This study *
jhp0917 _4 CATTCTGTCAAGAGCTACC    
jhp0918 _1 CCTATATCGCTAACGCGCGCTC 276 - Lu et al.,
jhp0918 _2 AAGCTGAAGCGTTTGTAACG    2005
jhp0918 _3 GCTAGAAAGATCAACGGAAC 216 - This study *
jhp0918 _4 CACTTGTCTGGCTCTCAT    
  1. *The primers were self-designed by applying Primer 3 and the restriction enzyme was selected based on the reference of Shibata et al, 2005.