Skip to main content

Table 3 Primers used in this study for access the relative gene expression by RT-qPCR

From: Efflux pumps expression and its association with porin down-regulation and β-lactamase production among Pseudomonas aeruginosa causing bloodstream infections in Brazil

Genes Primers Sequences (5'-3') Amplicon size (bp) References
mexB mexB-F GTGTTCGGCTCGCAGTACTC 244 [26]
  mexB-R AACCGTCGGGATTGACCTTG   
mexD mexD-F CGAGCGCTATTCGCTGC 165 This study
  mexD-R GGCAGTTGCACGTCGA   
mexF mexF-F CGCCTGGTCACCGAGGAAGAGT 255 [27]
  mexF-R TAGTCCATGGCTTGCGGGAAGC   
mexY mexY-F CCGCTACAACGGCTATCCCT 250 [26]
  mexY-R AGCGGGATCGACCAGCTTTC   
oprD oprD-F TCCGCAGGTAGCACTCAGTTC 191 [28]
  oprD-R AAGCCGGATTCATAGGTGGTG   
ampC ampC-F CTGTTCGAGATCGGCTC 166 This study
  ampC-R CGGTATAGGTCGCGAG   
rpsL rpsL-F GCAAGCGCATGGTCGACAAGA 201 [29]
  rpsL-R CGCTGTGCTCTTGCAGGTTGTGA