Skip to main content

Table 3 Oligonucleotide primers used in this study

From: The chitobiose transporter, chbC, is required for chitin utilization in Borrelia burgdorferi

Primer Name Sequence (5'→3')
5'BB0002mutF (KpnI) GCTAGGGTACCACATTGCCTTTATCGGAATATTGACATC
5'BB0002mutR (XbaI) GCTAGTCTAGAAAGATGCGGAGCAGACAAAGGGAT
pKFSS1 R1 TGATGAACAGGGTCACGTCGTC
3' BB0002mutF (XmaI) GCTAGCCCGGGCGATATTAAGCTCTTGAACATTCTTAAA
3'BB0002mutR (SacII) GCTAGCCGCGGTAGTGCTATTAGTGCTTTATCTTTATTG
5'BB0620mutF3 (KpnI) GCTAGGGTACCTACTTTGAATTTTGAATATGGAG
5'BB0620mutR2 (SalI) GCTAGGTCGACTACCCAAATCAATCAATCAC
pBSV2 R1 TTATTATCGTGCACTCCTCCCGGT
3'BB0620mutF2 (SacII) GCTAGCCGCGGCGTATCCCAAAAATCAATAGAAAA
3'BB0620mutR2 (AatII) GCTAGGACGTCATGCAATCACCGCAATAGAAGCGG
5'BBB04mutF2 (BamHI) GCTAGGGATCCGAATAAGTAGCTTTACGTCT
5'BBB04mutR2 (PstI) GCTAGCTGCAGTACCAACAGTGGTATGTTGA
3'BBB04mutF1 (XmaI) GCTAGCCCGGGCCAATTTTGCTAGCAATAGGA
3'BBB04mutR1 (SacII) GCTAGCCGCGGGCATCTGGATTTAGGTCTGCTTTGA
BBB04 complement F1 GCTTCATTACTTCAACAGGACGACG
BBB04 complement R1 TCGCTAAGGCGTGTCTCAGCAATA
chbC F1 GGGAATTCAGCCCAATTCATGGTTTCC
chbC R1 GGCGGAACAGACTCTGGAAGCTTAAT
BB0002 CF1 ATGGACTTTTTAAAAACCTTTTCTTTTTTGTTTTTTAGC
BB0002 CR1 CTAAGGAATGAGTACTATATTGACACCCGA
BB0620 mut confirm F1 TCAAGAGTGGTATTGCCGTGTCCT
BB0620 mut confirm R1 ACTTGAACCCACGACAACTCGGAT
BBB04 mut confirm F1 AGCAGCATCTCCACCGTAAGGTAT
BBB04 mut confirm R1 CACCAGAGTAAGCTACAACAGGCA