Skip to main content

Advertisement

Table 3 Oligonucleotides used in this study

From: The T box regulatory element controlling expression of the class I lysyl-tRNA synthetase of Bacillus cereus strain 14579 is functional and can be partially induced by reduced charging of asparaginyl-tRNAAsn

Primer Sequence (5'-3')
NF2F CGGAATTC CAAATGGCTTCTCGATCC
NF2R CGGAATTC GGTGAGTATTATCCTACTTTTGC
NF3R/2 CGGGATCC GCGTTGTGGTGAGTGATAAACGG
NF9R CGGAATTC CTTGCGTTGCTTTTAACTGTGTT
NF15F GGTGAGTAATATATGAGTCAAGAAGAGCATAACC
NF15R TTGACTCATATATTACTCACCTCAATTATTTTTTG
NF16F CCCAAGCTT CTTTCTTGTTTTGGAGGGAAATATG
NF16R CCCAAGCTT CCTTCAGGTGCGCTTCCAGTC
NF36F CGGAATTC CGATTTCGATTCGGAAAAGTTTG
NF36R CGGGATCC GCTACTTCATACGCCCAATGC
T7 TAATACGACTCACTATAGGG
M13 rev CAGGAAACAGCTATGACC
  1. * Added restriction sites are shown in bold.