Skip to main content

Advertisement

Table 1 Oligo DNAs used in this study

From: Establishment of a Cre/loxP recombination system for N-terminal epitope tagging of genes in Tetrahymena

Names DNA Sequences (5' to 3')
MTT5'FWXho GGCTCGAGTCTTTGCATTCTACTTCGAGC
MTT5'RV GATCTGGATCCATATGTTTAAGTTTAGTATTATTATTTATTTTATTAGAGC
MTT3'FW CATATGGGATCCAGATCTATATGTTAATTAAAATTTAAAATATGTTGATG
MTT3'RVSpe GCACTAGTAAATATCCAAAGATGTTTATGAG
MCSfw GATCCTAGTAGCCTAGGTAGTAGGCTAGCTAGTAGCAATTGCCTGCAGGACGCGTGATGAT
MCSrev GATCATCATCACGCGTCCTGCAGGCAATTGCTACTAGCTAGCCTACTACCTAGGCTACTAG
H4fw CGCAAGCTTGAGGTCGACGGTATCGATAAGCTTGATATCTTCAAAGTATGG
H4rev GCGTGTAAACCATCTTGTTCAATCATTTTTGTAAGTTTTTATAATCTTATTTGTTTTTCTATTTATTG
Neo4FW AGACAATTTATTTCTAAAAAATATTTAAAAATAAAAAATAATAAGGG
Neo4RV TGCATTTTTCCAGTAAAAATTTGAAAATTTAATGGC
HA-GA-Cre-NdeFW GGAATTCCATATGTATCCTTATGATGTTCCTGATTATGCTGGTGCTAGCAACCTGCTGACCGTTCATC
Cre-MluRV CGACGCGTCGTCAATCGCCATCTTCCAGCAGGC
LoxNeoFWXho GCGCTCGAGATAACTTCGTATAATGTATGCTATACGAAGTTATGGGCTGCAGGAATTCGATAGAC
LoxNeoRV CACCCTTAGAAACCATATAACTTCGTATAGCATACATTATACGAAGTTATGGGCTGCATTTTTCCAG
LoxGFPFW GCTATACGAAGTTATATGGTTTCTAAGGGTGAAGAACTTTTCACTGG
LoxGFPRVBam GCCGGATCCACTAGTCTTATATAATTCATCCATACC
TWI15LoxFW GTCAGAAGATCCTTTCTATGTGTCC
TWI15LoxRVATGplus CCTGCAGCCCATAACTTCGTATAGCATACATTATACGAAGTTATGACATGGATGTTAATTATATCGC
TWI1NGFPFW GGATGAATTATATAAGACTAGTATGTCTAACAAAGGCCTTGTC
TWI1NGFPRV GAGGCTAGTTTGGGTCGATGTTACC
EGFP-NtermRV CCATAAGTAAGAGTAGTAACTAAAGTAGGCCAAGG
XbaBTU15FW GGCGTCTAGAGTTGTTTGGATAATTAGATCTCTCTC
BTU1_5RV_SSS ACTAGTCCCGGGGTCGACATCACCCAAATAAATACACGC
BTU1_3FW_SSS GTCGACCCCGGGACTAGTTGAGCGAACTGAATCGGTCAGC
BTU13RVXho GCGGCTCGAGAAGATGTGGCTATTGATGGGC
neo5_FW_Sal CCGCGTCGACTTGATATCTTCAAAGTATGG
MTT1_MCS_RV CGCCACTAGTAGATCTGGATCATCATCACGCGTC
pBNMB_addXhoAS CCAAACAACTCTAGACTCGAGCGGCCGCCACCGC
pBNMB_addXhoS GCGGTGGCGGCCGCTCGAGTCTAGAGTTGTTTGG