Skip to main content

Advertisement

Table 4 Oligonucleotides used for construction of targeted deletion mutants.

From: The role of iron uptake in pathogenicity and symbiosis in Photorhabdus luminescens TT01

Gene(s) Sequence 5' to 3'* Name
exbD 1. TTATGCATGC GGTGATTGCTTCTGTTATTACTT GG RJW115
  2. GAATCAGTGACAATTACATAAGTCACCTTGTCTTG RJW116
  3. CAAGGTGACTTATGTAATTGTCACTGATTCTTCC RJW117
  4. TTATGAGCTC GCCAACCAATTTGCCTCTGCCCTAC RJW118
yfeABCD 1. TTATGCATGC GGTTATCAATACCTGCCAGATGC RJW171
  2. CCCTTTTTGTTACATAAATTCAAACC RJW172
  3. GGTTTGAATTTATGTAACAAAAAGGGTTATATCTG RJW173
  4. TTATGAGCTC GGTGTTGAAGTTTGTTACTTATAGC RJW174
feoABC 1. TTATGCATGC CGTAGTAAAAGCGGGTGATATCG RJW167
  2. GCTAATCATTTTCAATTCCTACATATGACCTTCCG RJW168
  3. CGGAAGGTCATATGTAGGAATTGAAAATGATTAGC RJW169
  4. TTATGAGCTC CCAAAACGCTTCTCTTAGAAGATGC RJW170
  1. *: the underlined sequence indicate the restriction endonuclease sites used for cloning the amplicon into pDS132.