Skip to main content

Table 4 Oligonucleotide primers used for RT-PCR.

From: Global transcriptional profiling of Burkholderia pseudomallei under salt stress reveals differential effects on the Bsa type III secretion system

Primer Names Oligo Sequences (5'-3') Purpose
BPSS2232 F CGGACTTCGACACCGACGCGCTGA Forward primer for BPSS2232
BPSS2232 R CGTGTGCCAGTCGCTGCCCGCGTA Reverse primer for BPSS2232
BPSS1272 F GGCACGAAGGAAGTCATCAA Forward primer for BPSS1272
BPSS1272 R CGACGCAGTATCTCCAGCTC Reverse primer for BPSS1272
BPSS2242 F GTGAGCCGCTACGAGGAC Forward primer for BPSS2242
BPSS2242 R ACGCCCCAGTAGTTCGTATC Reverse primer for BPSS2242
BopA F GTATTTCGGTCGTGGGAATG Forward primer for bopA
BopA R GCGATCGAAATGCTCCTTAC Reverse primer for bopA
BipD F GGACTACATCTCGGCCAAAG Forward primer for bipD
BipD R ATCAGCTTGTCCGGATTGAT Reverse primer for bipD
BopE F CGGCAAGTCTACGAAGCGA Forward primer for bopE
BopE R GCGGCGGTATGTGGCTTC G Reverse primer for bopE
23S F TTTCCCGCTTAGATGCTTT Forward primer for 23S rRNA
23S R AAAGGTACTCTGGGGATAA Reverse primer for 23S rRNA