Skip to main content

Advertisement

Table 3 Primer and probe sequences used for qPCR analysis.

From: Revealing fosfomycin primary effect on Staphylococcus aureus transcriptome: modulation of cell envelope biosynthesis and phosphoenolpyruvate induced starvation

Gene Name Forward Primer Reverse Primer Probe
murZ TGGTCCTTCATTTGTAACTGATACGATTT CCCATGCGCTTTAATTCTTCAACAT CCGGAGCGTTTTAAAC
atl CCCTACTACACCATCAAAACCAACA TGTGCGACACCATTGTTTGC ACACCGTCGAAACCAT
ribB CGTGCCATGAGTGGTAACG GTTCATCTACATGACCGAGGACAAA ATGTCCACCAAACCTAC
sgtB GAGCTTTATTTTCAACGATTAGCGACA AATTTTTGACAACTTGTTGTGTAATGGTACTAC CACCTTGCACATCTC
oppB TTTAGGTGTTGCAGCAGCTACT GTACAGCAAGTACAAAAGATGGTACAGA CAACCCAAGAATTTTG